Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807746257:

Variant ID: vg0807746257 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 7746257
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

CTAGTGAATGCTCTATTCACTAATGTTGAAGGTGACAAAAATAGGCTAAAACTGTCATGCCAAGGGTTCCTTGCTACAATAAAACAAAAGCAAATGCAGA[T/C]
GATGAATTAGCAGTGGAAACCTCATAACAAAAGAACCTTGGAAGTGCACGTAGAGTGCACCATTCCAGTACTCCGCACGTATAAATCGCGGTCCCCAAGA

Reverse complement sequence

TCTTGGGGACCGCGATTTATACGTGCGGAGTACTGGAATGGTGCACTCTACGTGCACTTCCAAGGTTCTTTTGTTATGAGGTTTCCACTGCTAATTCATC[A/G]
TCTGCATTTGCTTTTGTTTTATTGTAGCAAGGAACCCTTGGCATGACAGTTTTAGCCTATTTTTGTCACCTTCAACATTAGTGAATAGAGCATTCACTAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.00%	28.90%	0.08%	0.00%	NA
All Indica	2759	98.60%	1.30%	0.11%	0.00%	NA
All Japonica	1512	14.50%	85.50%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	95.30%	4.10%	0.65%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	98.90%	1.10%	0.00%	0.00%	NA
Temperate Japonica	767	16.90%	83.10%	0.00%	0.00%	NA
Tropical Japonica	504	7.10%	92.90%	0.00%	0.00%	NA
Japonica Intermediate	241	22.00%	78.00%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	61.10%	37.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0807746257	T -> C	LOC_Os08g13040.1	upstream_gene_variant ; 1520.0bp to feature; MODIFIER	silent_mutation	Average:68.127; most accessible tissue: Zhenshan97 panicle, score: 87.764	N	N	N	N
vg0807746257	T -> C	LOC_Os08g13030.1	downstream_gene_variant ; 4793.0bp to feature; MODIFIER	silent_mutation	Average:68.127; most accessible tissue: Zhenshan97 panicle, score: 87.764	N	N	N	N
vg0807746257	T -> C	LOC_Os08g13050.1	intron_variant ; MODIFIER	silent_mutation	Average:68.127; most accessible tissue: Zhenshan97 panicle, score: 87.764	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0807746257	NA	5.89E-34	mr1350	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807746257	NA	1.30E-08	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807746257	NA	2.17E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807746257	NA	2.96E-07	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807746257	NA	4.69E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807746257	NA	8.13E-105	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807746257	NA	1.85E-06	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807746257	NA	1.57E-06	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807746257	NA	8.84E-15	mr1162_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807746257	1.48E-06	1.06E-112	mr1203_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807746257	NA	3.79E-07	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807746257	NA	9.12E-24	mr1350_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807746257	NA	7.18E-45	mr1519_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807746257	NA	2.98E-25	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807746257	NA	9.60E-26	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807746257	NA	8.69E-31	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807746257	NA	1.74E-18	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807746257	NA	2.23E-67	mr1828_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807746257	NA	9.81E-07	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807746257	NA	7.11E-19	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807746257	NA	1.75E-20	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807746257	1.88E-06	1.88E-06	mr1973_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251