Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807743041:

Variant ID: vg0807743041 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 7743041
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTTGATATATATTTTGTTAGAAAATCATGTGCTACAATTAAGAGTCCGATCAACTTAAATTAGCATGCGAGTTTTTTAAAAGAGATTTTTTATATGATT[T/C]
CTTCTATATATTTCAAAAATGAACTAACTTAAAAACTGACTCAAATATGGATTTGTGTTTCTAAAAGCGAACGAACTTAAAAACCGACTTATATACAGAT

Reverse complement sequence

ATCTGTATATAAGTCGGTTTTTAAGTTCGTTCGCTTTTAGAAACACAAATCCATATTTGAGTCAGTTTTTAAGTTAGTTCATTTTTGAAATATATAGAAG[A/G]
AATCATATAAAAAATCTCTTTTAAAAAACTCGCATGCTAATTTAAGTTGATCGGACTCTTAATTGTAGCACATGATTTTCTAACAAAATATATATCAAGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.60%	27.80%	3.55%	0.02%	NA
All Indica	2759	94.40%	0.70%	4.89%	0.04%	NA
All Japonica	1512	16.30%	83.50%	0.13%	0.00%	NA
Aus	269	89.60%	0.00%	10.41%	0.00%	NA
Indica I	595	98.50%	0.50%	1.01%	0.00%	NA
Indica II	465	95.50%	0.90%	3.66%	0.00%	NA
Indica III	913	89.40%	0.40%	10.19%	0.00%	NA
Indica Intermediate	786	96.40%	1.00%	2.42%	0.13%	NA
Temperate Japonica	767	20.60%	79.40%	0.00%	0.00%	NA
Tropical Japonica	504	7.10%	92.90%	0.00%	0.00%	NA
Japonica Intermediate	241	22.00%	77.20%	0.83%	0.00%	NA
VI/Aromatic	96	94.80%	4.20%	1.04%	0.00%	NA
Intermediate	90	66.70%	31.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0807743041	T -> C	LOC_Os08g13030.1	downstream_gene_variant ; 1577.0bp to feature; MODIFIER	silent_mutation	Average:21.598; most accessible tissue: Callus, score: 48.638	N	N	N	N
vg0807743041	T -> C	LOC_Os08g13040.1	downstream_gene_variant ; 1337.0bp to feature; MODIFIER	silent_mutation	Average:21.598; most accessible tissue: Callus, score: 48.638	N	N	N	N
vg0807743041	T -> C	LOC_Os08g13050.1	downstream_gene_variant ; 3064.0bp to feature; MODIFIER	silent_mutation	Average:21.598; most accessible tissue: Callus, score: 48.638	N	N	N	N
vg0807743041	T -> C	LOC_Os08g13030-LOC_Os08g13040	intergenic_region ; MODIFIER	silent_mutation	Average:21.598; most accessible tissue: Callus, score: 48.638	N	N	N	N
vg0807743041	T -> DEL	N	N	silent_mutation	Average:21.598; most accessible tissue: Callus, score: 48.638	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0807743041	NA	1.39E-09	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041	NA	3.80E-44	mr1194	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041	NA	1.13E-19	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041	1.14E-06	1.19E-43	mr1563	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041	NA	6.99E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041	NA	9.98E-13	mr1641	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041	NA	6.92E-10	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041	NA	3.96E-16	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041	NA	3.58E-25	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041	NA	6.21E-06	mr1517_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041	NA	8.45E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041	2.63E-06	NA	mr1563_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041	NA	1.14E-31	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041	NA	5.35E-10	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041	NA	1.31E-23	mr1708_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041	NA	3.32E-19	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251