\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807743041:

Variant ID: vg0807743041 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 7743041
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTTGATATATATTTTGTTAGAAAATCATGTGCTACAATTAAGAGTCCGATCAACTTAAATTAGCATGCGAGTTTTTTAAAAGAGATTTTTTATATGATT[T/C]
CTTCTATATATTTCAAAAATGAACTAACTTAAAAACTGACTCAAATATGGATTTGTGTTTCTAAAAGCGAACGAACTTAAAAACCGACTTATATACAGAT

Reverse complement sequence

ATCTGTATATAAGTCGGTTTTTAAGTTCGTTCGCTTTTAGAAACACAAATCCATATTTGAGTCAGTTTTTAAGTTAGTTCATTTTTGAAATATATAGAAG[A/G]
AATCATATAAAAAATCTCTTTTAAAAAACTCGCATGCTAATTTAAGTTGATCGGACTCTTAATTGTAGCACATGATTTTCTAACAAAATATATATCAAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.60% 27.80% 3.55% 0.02% NA
All Indica  2759 94.40% 0.70% 4.89% 0.04% NA
All Japonica  1512 16.30% 83.50% 0.13% 0.00% NA
Aus  269 89.60% 0.00% 10.41% 0.00% NA
Indica I  595 98.50% 0.50% 1.01% 0.00% NA
Indica II  465 95.50% 0.90% 3.66% 0.00% NA
Indica III  913 89.40% 0.40% 10.19% 0.00% NA
Indica Intermediate  786 96.40% 1.00% 2.42% 0.13% NA
Temperate Japonica  767 20.60% 79.40% 0.00% 0.00% NA
Tropical Japonica  504 7.10% 92.90% 0.00% 0.00% NA
Japonica Intermediate  241 22.00% 77.20% 0.83% 0.00% NA
VI/Aromatic  96 94.80% 4.20% 1.04% 0.00% NA
Intermediate  90 66.70% 31.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0807743041 T -> C LOC_Os08g13030.1 downstream_gene_variant ; 1577.0bp to feature; MODIFIER silent_mutation Average:21.598; most accessible tissue: Callus, score: 48.638 N N N N
vg0807743041 T -> C LOC_Os08g13040.1 downstream_gene_variant ; 1337.0bp to feature; MODIFIER silent_mutation Average:21.598; most accessible tissue: Callus, score: 48.638 N N N N
vg0807743041 T -> C LOC_Os08g13050.1 downstream_gene_variant ; 3064.0bp to feature; MODIFIER silent_mutation Average:21.598; most accessible tissue: Callus, score: 48.638 N N N N
vg0807743041 T -> C LOC_Os08g13030-LOC_Os08g13040 intergenic_region ; MODIFIER silent_mutation Average:21.598; most accessible tissue: Callus, score: 48.638 N N N N
vg0807743041 T -> DEL N N silent_mutation Average:21.598; most accessible tissue: Callus, score: 48.638 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0807743041 NA 1.39E-09 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041 NA 3.80E-44 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041 NA 1.13E-19 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041 1.14E-06 1.19E-43 mr1563 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041 NA 6.99E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041 NA 9.98E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041 NA 6.92E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041 NA 3.96E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041 NA 3.58E-25 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041 NA 6.21E-06 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041 NA 8.45E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041 2.63E-06 NA mr1563_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041 NA 1.14E-31 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041 NA 5.35E-10 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041 NA 1.31E-23 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807743041 NA 3.32E-19 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251