\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807716778:

Variant ID: vg0807716778 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 7716778
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, C: 0.46, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


CCATGCACTGTTTGTATATATCTGCGCCCTCCCGTGGGTGGAGGTTCCTCTGTCGCTCGATCGTCAACTTGTCATTCGCCATCCTAATACTTGTTCGTTC[C/T]
CAATATTTTTGAGGTATTAAGAAAGTATGTTAAGATGATTATTGAAAGAAGTGTGTGATTGGTTGAAAAGAAAAAGTAGGTCAAAGAGAATAGTCAATAG

Reverse complement sequence

CTATTGACTATTCTCTTTGACCTACTTTTTCTTTTCAACCAATCACACACTTCTTTCAATAATCATCTTAACATACTTTCTTAATACCTCAAAAATATTG[G/A]
GAACGAACAAGTATTAGGATGGCGAATGACAAGTTGACGATCGAGCGACAGAGGAACCTCCACCCACGGGAGGGCGCAGATATATACAAACAGTGCATGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.60% 44.60% 0.32% 3.45% NA
All Indica  2759 29.80% 65.00% 0.36% 4.78% NA
All Japonica  1512 91.50% 8.20% 0.20% 0.07% NA
Aus  269 60.20% 29.40% 0.00% 10.41% NA
Indica I  595 3.50% 95.50% 0.17% 0.84% NA
Indica II  465 56.10% 40.40% 0.22% 3.23% NA
Indica III  913 34.60% 55.00% 0.22% 10.19% NA
Indica Intermediate  786 28.60% 68.20% 0.76% 2.42% NA
Temperate Japonica  767 96.90% 3.10% 0.00% 0.00% NA
Tropical Japonica  504 92.70% 7.10% 0.20% 0.00% NA
Japonica Intermediate  241 72.20% 26.60% 0.83% 0.41% NA
VI/Aromatic  96 16.70% 82.30% 0.00% 1.04% NA
Intermediate  90 58.90% 37.80% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0807716778 C -> T LOC_Os08g12990.1 upstream_gene_variant ; 153.0bp to feature; MODIFIER silent_mutation Average:59.131; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0807716778 C -> T LOC_Os08g13000.1 upstream_gene_variant ; 1336.0bp to feature; MODIFIER silent_mutation Average:59.131; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0807716778 C -> T LOC_Os08g12990-LOC_Os08g13000 intergenic_region ; MODIFIER silent_mutation Average:59.131; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0807716778 C -> DEL N N silent_mutation Average:59.131; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0807716778 2.44E-06 2.44E-06 mr1008 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807716778 1.59E-06 1.59E-06 mr1009 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807716778 NA 2.70E-07 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807716778 NA 7.05E-08 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251