\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807552457:

Variant ID: vg0807552457 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 7552457
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.08, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TATTTTTTTAACGTAGTTTCTTTTTCAGCATTGGCTTTTATATCACCGAGAACACATATATAAAAGTTTTACCTACAAATTCATTTTTATTTTCTAATAA[A/G]
TTGTTTTGGCTTATTAGAAAAAAGCCAAACAATGGGGCCCTTTGTGAATGGAAGAAAGAAGAGAGATCGTTTGACTTAAATTTGGAGTTGATTCTTGCTT

Reverse complement sequence

AAGCAAGAATCAACTCCAAATTTAAGTCAAACGATCTCTCTTCTTTCTTCCATTCACAAAGGGCCCCATTGTTTGGCTTTTTTCTAATAAGCCAAAACAA[T/C]
TTATTAGAAAATAAAAATGAATTTGTAGGTAAAACTTTTATATATGTGTTCTCGGTGATATAAAAGCCAATGCTGAAAAAGAAACTACGTTAAAAAAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.70% 30.20% 0.15% 0.00% NA
All Indica  2759 99.00% 0.80% 0.22% 0.00% NA
All Japonica  1512 9.50% 90.50% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.20% 0.50% 0.00% NA
Indica II  465 97.60% 2.20% 0.22% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.10% 0.25% 0.00% NA
Temperate Japonica  767 14.50% 85.40% 0.13% 0.00% NA
Tropical Japonica  504 4.00% 96.00% 0.00% 0.00% NA
Japonica Intermediate  241 5.00% 95.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 62.20% 37.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0807552457 A -> G LOC_Os08g12740.1 upstream_gene_variant ; 482.0bp to feature; MODIFIER silent_mutation Average:35.828; most accessible tissue: Callus, score: 75.382 N N N N
vg0807552457 A -> G LOC_Os08g12750.1 upstream_gene_variant ; 1312.0bp to feature; MODIFIER silent_mutation Average:35.828; most accessible tissue: Callus, score: 75.382 N N N N
vg0807552457 A -> G LOC_Os08g12740.2 upstream_gene_variant ; 468.0bp to feature; MODIFIER silent_mutation Average:35.828; most accessible tissue: Callus, score: 75.382 N N N N
vg0807552457 A -> G LOC_Os08g12740-LOC_Os08g12750 intergenic_region ; MODIFIER silent_mutation Average:35.828; most accessible tissue: Callus, score: 75.382 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0807552457 NA 2.97E-13 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807552457 NA 1.31E-43 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807552457 NA 1.39E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807552457 NA 4.24E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807552457 NA 2.22E-20 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807552457 NA 2.95E-23 mr1383_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807552457 NA 2.30E-25 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807552457 NA 1.25E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807552457 NA 1.23E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807552457 NA 5.12E-19 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807552457 NA 1.02E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251