Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0807552457:

Variant ID: vg0807552457 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 7552457
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.08, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

TATTTTTTTAACGTAGTTTCTTTTTCAGCATTGGCTTTTATATCACCGAGAACACATATATAAAAGTTTTACCTACAAATTCATTTTTATTTTCTAATAA[A/G]
TTGTTTTGGCTTATTAGAAAAAAGCCAAACAATGGGGCCCTTTGTGAATGGAAGAAAGAAGAGAGATCGTTTGACTTAAATTTGGAGTTGATTCTTGCTT

Reverse complement sequence

AAGCAAGAATCAACTCCAAATTTAAGTCAAACGATCTCTCTTCTTTCTTCCATTCACAAAGGGCCCCATTGTTTGGCTTTTTTCTAATAAGCCAAAACAA[T/C]
TTATTAGAAAATAAAAATGAATTTGTAGGTAAAACTTTTATATATGTGTTCTCGGTGATATAAAAGCCAATGCTGAAAAAGAAACTACGTTAAAAAAATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.70%	30.20%	0.15%	0.00%	NA
All Indica	2759	99.00%	0.80%	0.22%	0.00%	NA
All Japonica	1512	9.50%	90.50%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.30%	0.20%	0.50%	0.00%	NA
Indica II	465	97.60%	2.20%	0.22%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	98.60%	1.10%	0.25%	0.00%	NA
Temperate Japonica	767	14.50%	85.40%	0.13%	0.00%	NA
Tropical Japonica	504	4.00%	96.00%	0.00%	0.00%	NA
Japonica Intermediate	241	5.00%	95.00%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	62.20%	37.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0807552457	A -> G	LOC_Os08g12740.1	upstream_gene_variant ; 482.0bp to feature; MODIFIER	silent_mutation	Average:35.828; most accessible tissue: Callus, score: 75.382	N	N	N	N
vg0807552457	A -> G	LOC_Os08g12750.1	upstream_gene_variant ; 1312.0bp to feature; MODIFIER	silent_mutation	Average:35.828; most accessible tissue: Callus, score: 75.382	N	N	N	N
vg0807552457	A -> G	LOC_Os08g12740.2	upstream_gene_variant ; 468.0bp to feature; MODIFIER	silent_mutation	Average:35.828; most accessible tissue: Callus, score: 75.382	N	N	N	N
vg0807552457	A -> G	LOC_Os08g12740-LOC_Os08g12750	intergenic_region ; MODIFIER	silent_mutation	Average:35.828; most accessible tissue: Callus, score: 75.382	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0807552457	NA	2.97E-13	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807552457	NA	1.31E-43	mr1194	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807552457	NA	1.39E-23	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807552457	NA	4.24E-20	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807552457	NA	2.22E-20	mr1168_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807552457	NA	2.95E-23	mr1383_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807552457	NA	2.30E-25	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807552457	NA	1.25E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807552457	NA	1.23E-08	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807552457	NA	5.12E-19	mr1817_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807552457	NA	1.02E-18	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251