\
| Variant ID: vg0807552457 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 7552457 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.08, others allele: 0.00, population size: 109. )
TATTTTTTTAACGTAGTTTCTTTTTCAGCATTGGCTTTTATATCACCGAGAACACATATATAAAAGTTTTACCTACAAATTCATTTTTATTTTCTAATAA[A/G]
TTGTTTTGGCTTATTAGAAAAAAGCCAAACAATGGGGCCCTTTGTGAATGGAAGAAAGAAGAGAGATCGTTTGACTTAAATTTGGAGTTGATTCTTGCTT
AAGCAAGAATCAACTCCAAATTTAAGTCAAACGATCTCTCTTCTTTCTTCCATTCACAAAGGGCCCCATTGTTTGGCTTTTTTCTAATAAGCCAAAACAA[T/C]
TTATTAGAAAATAAAAATGAATTTGTAGGTAAAACTTTTATATATGTGTTCTCGGTGATATAAAAGCCAATGCTGAAAAAGAAACTACGTTAAAAAAATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.70% | 30.20% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 99.00% | 0.80% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 9.50% | 90.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.20% | 0.50% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 14.50% | 85.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 4.00% | 96.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.00% | 95.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 37.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0807552457 | A -> G | LOC_Os08g12740.1 | upstream_gene_variant ; 482.0bp to feature; MODIFIER | silent_mutation | Average:35.828; most accessible tissue: Callus, score: 75.382 | N | N | N | N |
| vg0807552457 | A -> G | LOC_Os08g12750.1 | upstream_gene_variant ; 1312.0bp to feature; MODIFIER | silent_mutation | Average:35.828; most accessible tissue: Callus, score: 75.382 | N | N | N | N |
| vg0807552457 | A -> G | LOC_Os08g12740.2 | upstream_gene_variant ; 468.0bp to feature; MODIFIER | silent_mutation | Average:35.828; most accessible tissue: Callus, score: 75.382 | N | N | N | N |
| vg0807552457 | A -> G | LOC_Os08g12740-LOC_Os08g12750 | intergenic_region ; MODIFIER | silent_mutation | Average:35.828; most accessible tissue: Callus, score: 75.382 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0807552457 | NA | 2.97E-13 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807552457 | NA | 1.31E-43 | mr1194 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807552457 | NA | 1.39E-23 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807552457 | NA | 4.24E-20 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807552457 | NA | 2.22E-20 | mr1168_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807552457 | NA | 2.95E-23 | mr1383_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807552457 | NA | 2.30E-25 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807552457 | NA | 1.25E-10 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807552457 | NA | 1.23E-08 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807552457 | NA | 5.12E-19 | mr1817_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807552457 | NA | 1.02E-18 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |