\
| Variant ID: vg0807470228 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 7470228 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 89. )
GTGCGCCTGACATCCTGGGTCCCATCAGTCATTCGACCGGTCACAGACCGGTTGAGTGCACTGCACACTGCATTAAATGCGGTGTGGCGCGACCGCTTGG[A/G]
TTGCCATAAATGCGGGTAGGTGGGCACCTGGAGGCGGACACCTAACCCACCGTACGTGGAGACATAGAGAGGGGGTCGGCGGAGCCCGACCCCTAGTCAC
GTGACTAGGGGTCGGGCTCCGCCGACCCCCTCTCTATGTCTCCACGTACGGTGGGTTAGGTGTCCGCCTCCAGGTGCCCACCTACCCGCATTTATGGCAA[T/C]
CCAAGCGGTCGCGCCACACCGCATTTAATGCAGTGTGCAGTGCACTCAACCGGTCTGTGACCGGTCGAATGACTGATGGGACCCAGGATGTCAGGCGCAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.90% | 21.40% | 15.57% | 29.16% | NA |
| All Indica | 2759 | 3.90% | 25.10% | 22.62% | 48.39% | NA |
| All Japonica | 1512 | 96.00% | 1.60% | 1.12% | 1.26% | NA |
| Aus | 269 | 0.70% | 75.80% | 22.30% | 1.12% | NA |
| Indica I | 595 | 7.40% | 11.10% | 6.05% | 75.46% | NA |
| Indica II | 465 | 4.50% | 43.90% | 12.47% | 39.14% | NA |
| Indica III | 913 | 1.40% | 21.00% | 41.29% | 36.25% | NA |
| Indica Intermediate | 786 | 3.70% | 29.40% | 19.47% | 47.46% | NA |
| Temperate Japonica | 767 | 95.80% | 0.50% | 1.56% | 2.09% | NA |
| Tropical Japonica | 504 | 96.20% | 2.80% | 0.79% | 0.20% | NA |
| Japonica Intermediate | 241 | 96.30% | 2.50% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 4.20% | 72.90% | 22.92% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 22.20% | 14.44% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0807470228 | A -> G | LOC_Os08g12630.1 | downstream_gene_variant ; 497.0bp to feature; MODIFIER | silent_mutation | Average:52.638; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0807470228 | A -> G | LOC_Os08g12620-LOC_Os08g12630 | intergenic_region ; MODIFIER | silent_mutation | Average:52.638; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0807470228 | A -> DEL | N | N | silent_mutation | Average:52.638; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0807470228 | NA | 1.06E-44 | mr1136 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 2.22E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 1.96E-47 | mr1194 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 3.69E-23 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 4.21E-36 | mr1402 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | 2.03E-08 | 2.27E-09 | mr1415 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 3.17E-41 | mr1480 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 6.38E-18 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | 2.03E-08 | 2.27E-09 | mr1567 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 4.15E-06 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 1.74E-23 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | 6.02E-06 | 4.29E-07 | mr1588 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 1.49E-08 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 1.73E-14 | mr1641 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 1.97E-53 | mr1692 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 3.28E-18 | mr1715 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 2.42E-06 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 2.27E-34 | mr1780 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 5.91E-08 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 3.96E-22 | mr1839 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 5.34E-14 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 3.88E-10 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 2.31E-15 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 1.65E-07 | mr1334_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 1.02E-18 | mr1383_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 3.56E-35 | mr1448_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 3.79E-53 | mr1480_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | 6.72E-06 | NA | mr1567_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 7.64E-12 | mr1636_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 2.34E-13 | mr1641_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 2.13E-24 | mr1653_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 3.14E-18 | mr1682_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 2.93E-08 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 2.25E-16 | mr1715_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 1.12E-34 | mr1780_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | 8.48E-07 | 1.82E-06 | mr1806_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 8.54E-15 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470228 | NA | 4.56E-22 | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |