| Variant ID: vg0807470225 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 7470225 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 90. )
ATGGTGCGCCTGACATCCTGGGTCCCATCAGTCATTCGACCGGTCACAGACCGGTTGAGTGCACTGCACACTGCATTAAATGCGGTGTGGCGCGACCGCT[T/C]
GGATTGCCATAAATGCGGGTAGGTGGGCACCTGGAGGCGGACACCTAACCCACCGTACGTGGAGACATAGAGAGGGGGTCGGCGGAGCCCGACCCCTAGT
ACTAGGGGTCGGGCTCCGCCGACCCCCTCTCTATGTCTCCACGTACGGTGGGTTAGGTGTCCGCCTCCAGGTGCCCACCTACCCGCATTTATGGCAATCC[A/G]
AGCGGTCGCGCCACACCGCATTTAATGCAGTGTGCAGTGCACTCAACCGGTCTGTGACCGGTCGAATGACTGATGGGACCCAGGATGTCAGGCGCACCAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.00% | 21.20% | 15.38% | 29.39% | NA |
| All Indica | 2759 | 4.20% | 24.80% | 22.18% | 48.82% | NA |
| All Japonica | 1512 | 96.00% | 1.50% | 1.32% | 1.19% | NA |
| Aus | 269 | 0.70% | 75.80% | 22.30% | 1.12% | NA |
| Indica I | 595 | 7.60% | 10.90% | 5.55% | 75.97% | NA |
| Indica II | 465 | 4.10% | 43.20% | 12.26% | 40.43% | NA |
| Indica III | 913 | 1.90% | 20.60% | 41.18% | 36.36% | NA |
| Indica Intermediate | 786 | 4.30% | 29.40% | 18.58% | 47.71% | NA |
| Temperate Japonica | 767 | 95.80% | 0.40% | 1.83% | 1.96% | NA |
| Tropical Japonica | 504 | 96.00% | 2.80% | 0.99% | 0.20% | NA |
| Japonica Intermediate | 241 | 96.30% | 2.50% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 4.20% | 72.90% | 22.92% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 22.20% | 14.44% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0807470225 | T -> C | LOC_Os08g12630.1 | downstream_gene_variant ; 500.0bp to feature; MODIFIER | silent_mutation | Average:52.713; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0807470225 | T -> C | LOC_Os08g12620-LOC_Os08g12630 | intergenic_region ; MODIFIER | silent_mutation | Average:52.713; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0807470225 | T -> DEL | N | N | silent_mutation | Average:52.713; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0807470225 | NA | 1.40E-43 | mr1136 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470225 | NA | 1.04E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470225 | NA | 6.33E-46 | mr1194 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470225 | NA | 4.60E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470225 | 2.09E-08 | 2.28E-09 | mr1415 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470225 | NA | 6.52E-40 | mr1480 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470225 | 2.09E-08 | 2.28E-09 | mr1567 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470225 | NA | 5.48E-06 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470225 | NA | 1.70E-23 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807470225 | 6.10E-06 | 4.17E-07 | mr1588 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/