\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807470225:

Variant ID: vg0807470225 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 7470225
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGTGCGCCTGACATCCTGGGTCCCATCAGTCATTCGACCGGTCACAGACCGGTTGAGTGCACTGCACACTGCATTAAATGCGGTGTGGCGCGACCGCT[T/C]
GGATTGCCATAAATGCGGGTAGGTGGGCACCTGGAGGCGGACACCTAACCCACCGTACGTGGAGACATAGAGAGGGGGTCGGCGGAGCCCGACCCCTAGT

Reverse complement sequence

ACTAGGGGTCGGGCTCCGCCGACCCCCTCTCTATGTCTCCACGTACGGTGGGTTAGGTGTCCGCCTCCAGGTGCCCACCTACCCGCATTTATGGCAATCC[A/G]
AGCGGTCGCGCCACACCGCATTTAATGCAGTGTGCAGTGCACTCAACCGGTCTGTGACCGGTCGAATGACTGATGGGACCCAGGATGTCAGGCGCACCAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.00% 21.20% 15.38% 29.39% NA
All Indica  2759 4.20% 24.80% 22.18% 48.82% NA
All Japonica  1512 96.00% 1.50% 1.32% 1.19% NA
Aus  269 0.70% 75.80% 22.30% 1.12% NA
Indica I  595 7.60% 10.90% 5.55% 75.97% NA
Indica II  465 4.10% 43.20% 12.26% 40.43% NA
Indica III  913 1.90% 20.60% 41.18% 36.36% NA
Indica Intermediate  786 4.30% 29.40% 18.58% 47.71% NA
Temperate Japonica  767 95.80% 0.40% 1.83% 1.96% NA
Tropical Japonica  504 96.00% 2.80% 0.99% 0.20% NA
Japonica Intermediate  241 96.30% 2.50% 0.41% 0.83% NA
VI/Aromatic  96 4.20% 72.90% 22.92% 0.00% NA
Intermediate  90 40.00% 22.20% 14.44% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0807470225 T -> C LOC_Os08g12630.1 downstream_gene_variant ; 500.0bp to feature; MODIFIER silent_mutation Average:52.713; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0807470225 T -> C LOC_Os08g12620-LOC_Os08g12630 intergenic_region ; MODIFIER silent_mutation Average:52.713; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0807470225 T -> DEL N N silent_mutation Average:52.713; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0807470225 NA 1.40E-43 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 1.04E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 6.33E-46 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 4.60E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 2.09E-08 2.28E-09 mr1415 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 6.52E-40 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 2.09E-08 2.28E-09 mr1567 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 5.48E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 1.70E-23 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 6.10E-06 4.17E-07 mr1588 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 3.45E-14 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 6.33E-52 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 3.84E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 1.10E-33 mr1780 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 3.38E-08 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 1.56E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 9.56E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 2.65E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 7.32E-15 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 1.73E-07 mr1334_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 1.40E-33 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 6.02E-52 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 5.68E-06 NA mr1567_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 3.03E-14 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 7.75E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 1.34E-13 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 2.17E-18 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 2.32E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 8.87E-17 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 4.26E-34 mr1780_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 6.57E-07 1.40E-06 mr1806_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 7.80E-15 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807470225 NA 6.65E-22 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251