Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807447586:

Variant ID: vg0807447586 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 7447586
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCTACTGTTTCTATTCAACTATTGCATTTATTTTCGAATGTCATTGGGTGGAATTAACCTATTCTTTGTTATAGCCCTCTTGTTCTTGATTACTTTCTTC[T/C]
TTGATACCTTGGGTTATTATAACTTGACTAGTTGGGCTATATATATTGGTTCAGCTAGATATTAGATGTGATTACCTAGCCCTGCTTAGAAACATTAGCA

Reverse complement sequence

TGCTAATGTTTCTAAGCAGGGCTAGGTAATCACATCTAATATCTAGCTGAACCAATATATATAGCCCAACTAGTCAAGTTATAATAACCCAAGGTATCAA[A/G]
GAAGAAAGTAATCAAGAACAAGAGGGCTATAACAAAGAATAGGTTAATTCCACCCAATGACATTCGAAAATAAATGCAATAGTTGAATAGAAACAGTAGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.30%	2.70%	4.55%	27.47%	NA
All Indica	2759	53.70%	0.30%	4.89%	41.10%	NA
All Japonica	1512	89.20%	7.90%	0.93%	1.98%	NA
Aus	269	49.80%	0.00%	16.36%	33.83%	NA
Indica I	595	49.10%	0.30%	3.53%	47.06%	NA
Indica II	465	38.50%	0.00%	5.38%	56.13%	NA
Indica III	913	67.60%	0.40%	4.49%	27.49%	NA
Indica Intermediate	786	50.00%	0.40%	6.11%	43.51%	NA
Temperate Japonica	767	83.10%	13.40%	1.69%	1.83%	NA
Tropical Japonica	504	98.00%	0.00%	0.00%	1.98%	NA
Japonica Intermediate	241	90.50%	6.60%	0.41%	2.49%	NA
VI/Aromatic	96	58.30%	0.00%	18.75%	22.92%	NA
Intermediate	90	71.10%	1.10%	4.44%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0807447586	T -> C	LOC_Os08g12570.1	upstream_gene_variant ; 4347.0bp to feature; MODIFIER	silent_mutation	Average:24.416; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg0807447586	T -> C	LOC_Os08g12580.1	upstream_gene_variant ; 2886.0bp to feature; MODIFIER	silent_mutation	Average:24.416; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg0807447586	T -> C	LOC_Os08g12590.1	upstream_gene_variant ; 1887.0bp to feature; MODIFIER	silent_mutation	Average:24.416; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg0807447586	T -> C	LOC_Os08g12600.1	upstream_gene_variant ; 3777.0bp to feature; MODIFIER	silent_mutation	Average:24.416; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg0807447586	T -> C	LOC_Os08g12580-LOC_Os08g12590	intergenic_region ; MODIFIER	silent_mutation	Average:24.416; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg0807447586	T -> DEL	N	N	silent_mutation	Average:24.416; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0807447586	3.49E-06	2.10E-06	mr1380	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807447586	NA	1.58E-06	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807447586	NA	1.12E-07	mr1648	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807447586	NA	1.05E-06	mr1697	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807447586	NA	1.17E-06	mr1697	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807447586	NA	5.78E-06	mr1826	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807447586	NA	8.23E-06	mr1051_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807447586	NA	8.55E-06	mr1358_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251