\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807415288:

Variant ID: vg0807415288 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 7415288
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


TGCCTCCTGGGACAAGGAATAATACACGCACGTAAGGAACGCCCGTTGGGTTAATTCCGGTCGTGACAAGTTGGTATCAGAGCCCCCTTGACCCTAGGAC[A/G]
AGCCTTAGATCCCAAGCCTTAGCAATATTTTCGAAATAAAAAAAAATCCTTTGTTATTTGTGAAAATCCTCTAGTCTCTCTCTGTCCTGCTGCTTCATTT

Reverse complement sequence

AAATGAAGCAGCAGGACAGAGAGAGACTAGAGGATTTTCACAAATAACAAAGGATTTTTTTTTATTTCGAAAATATTGCTAAGGCTTGGGATCTAAGGCT[T/C]
GTCCTAGGGTCAAGGGGGCTCTGATACCAACTTGTCACGACCGGAATTAACCCAACGGGCGTTCCTTACGTGCGTGTATTATTCCTTGTCCCAGGAGGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.00% 35.90% 5.06% 0.00% NA
All Indica  2759 83.30% 12.70% 4.06% 0.00% NA
All Japonica  1512 20.90% 78.00% 1.12% 0.00% NA
Aus  269 23.80% 43.50% 32.71% 0.00% NA
Indica I  595 62.00% 33.40% 4.54% 0.00% NA
Indica II  465 82.40% 9.20% 8.39% 0.00% NA
Indica III  913 98.40% 1.00% 0.66% 0.00% NA
Indica Intermediate  786 82.30% 12.60% 5.09% 0.00% NA
Temperate Japonica  767 37.30% 61.80% 0.91% 0.00% NA
Tropical Japonica  504 1.20% 96.80% 1.98% 0.00% NA
Japonica Intermediate  241 10.00% 90.00% 0.00% 0.00% NA
VI/Aromatic  96 71.90% 10.40% 17.71% 0.00% NA
Intermediate  90 48.90% 45.60% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0807415288 A -> G LOC_Os08g12520.1 downstream_gene_variant ; 3894.0bp to feature; MODIFIER silent_mutation Average:40.288; most accessible tissue: Zhenshan97 flag leaf, score: 86.452 N N N N
vg0807415288 A -> G LOC_Os08g12530.1 intron_variant ; MODIFIER silent_mutation Average:40.288; most accessible tissue: Zhenshan97 flag leaf, score: 86.452 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0807415288 NA 8.60E-17 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807415288 NA 2.90E-15 mr1626 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807415288 NA 8.27E-12 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807415288 NA 5.52E-09 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807415288 NA 7.34E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807415288 NA 1.03E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807415288 NA 3.52E-12 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807415288 NA 2.43E-07 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807415288 NA 8.97E-21 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807415288 NA 1.56E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807415288 NA 1.38E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807415288 NA 8.19E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807415288 NA 6.11E-06 mr1470_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807415288 NA 1.67E-06 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807415288 NA 1.36E-13 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807415288 NA 1.58E-14 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807415288 NA 1.61E-13 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251