\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807410855:

Variant ID: vg0807410855 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 7410855
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TCATCTTAGTCACCAAGATCCAAGCCCTCACTAGTGAGGCGTACGCGATAAGAGACATGGGCATCAGGGACGAAAACATCAATAACTGCGGGTCTTTCTT[T/C]
GCCATTGGCGAAACCTTTTCGGACACCACCAACTCGACGCTATACGCGCTCGAGCGCCTCACTGCCGCCGGAGAAGGTAAACGCAGTAAGGAGGACCTGG

Reverse complement sequence

CCAGGTCCTCCTTACTGCGTTTACCTTCTCCGGCGGCAGTGAGGCGCTCGAGCGCGTATAGCGTCGAGTTGGTGGTGTCCGAAAAGGTTTCGCCAATGGC[A/G]
AAGAAAGACCCGCAGTTATTGATGTTTTCGTCCCTGATGCCCATGTCTCTTATCGCGTACGCCTCACTAGTGAGGGCTTGGATCTTGGTGACTAAGATGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.80% 36.80% 1.31% 22.09% NA
All Indica  2759 14.50% 48.60% 1.81% 35.09% NA
All Japonica  1512 94.70% 4.30% 0.20% 0.79% NA
Aus  269 1.50% 84.00% 2.23% 12.27% NA
Indica I  595 38.80% 17.50% 2.52% 41.18% NA
Indica II  465 11.40% 57.40% 1.51% 29.68% NA
Indica III  913 1.30% 58.10% 1.10% 39.54% NA
Indica Intermediate  786 13.20% 56.00% 2.29% 28.50% NA
Temperate Japonica  767 95.00% 3.40% 0.26% 1.30% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 90.50% 8.30% 0.41% 0.83% NA
VI/Aromatic  96 3.10% 79.20% 2.08% 15.62% NA
Intermediate  90 46.70% 34.40% 1.11% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0807410855 T -> C LOC_Os08g12520.1 synonymous_variant ; p.Phe137Phe; LOW synonymous_codon Average:57.923; most accessible tissue: Zhenshan97 young leaf, score: 93.129 N N N N
vg0807410855 T -> DEL LOC_Os08g12520.1 N frameshift_variant Average:57.923; most accessible tissue: Zhenshan97 young leaf, score: 93.129 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0807410855 T C -0.01 -0.04 -0.03 -0.01 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0807410855 NA 1.71E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807410855 NA 4.48E-06 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807410855 NA 5.71E-09 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807410855 NA 4.01E-16 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807410855 NA 1.97E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807410855 2.80E-06 NA mr1381_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807410855 4.05E-07 1.97E-07 mr1381_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807410855 NA 4.67E-06 mr1458_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807410855 NA 1.76E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807410855 2.06E-06 7.16E-08 mr1567_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807410855 NA 1.44E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807410855 NA 4.78E-08 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807410855 NA 1.49E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807410855 NA 1.04E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807410855 NA 3.90E-06 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807410855 NA 4.68E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807410855 NA 3.91E-08 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807410855 NA 4.38E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251