\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807399839:

Variant ID: vg0807399839 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 7399839
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTGACTGATGGAGGCGTAATGATTGATGACAGTGGGATGACAACTGTTGACCTTAACAAGGTTGGATACTCGGATGAACCTTTTGTCCTTGCCAATGAT[G/A]
TAACGCAAGTAACATATATATATATATATATGTTACTTCGCATTTATCCTAATACATCTTTTTGTATCTTGCAGAAAAGACGTGTTGTCGGAGTCGTCCG

Reverse complement sequence

CGGACGACTCCGACAACACGTCTTTTCTGCAAGATACAAAAAGATGTATTAGGATAAATGCGAAGTAACATATATATATATATATATGTTACTTGCGTTA[C/T]
ATCATTGGCAAGGACAAAAGGTTCATCCGAGTATCCAACCTTGTTAAGGTCAACAGTTGTCATCCCACTGTCATCAATCATTACGCCTCCATCAGTCAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.90% 2.80% 5.35% 60.94% NA
All Indica  2759 13.20% 0.10% 6.13% 80.65% NA
All Japonica  1512 69.80% 8.40% 3.97% 17.86% NA
Aus  269 1.10% 0.00% 6.69% 92.19% NA
Indica I  595 32.90% 0.00% 5.88% 61.18% NA
Indica II  465 11.80% 0.00% 10.54% 77.63% NA
Indica III  913 1.30% 0.20% 2.85% 95.62% NA
Indica Intermediate  786 12.70% 0.00% 7.51% 79.77% NA
Temperate Japonica  767 62.20% 0.40% 5.87% 31.55% NA
Tropical Japonica  504 85.70% 10.30% 1.39% 2.58% NA
Japonica Intermediate  241 60.60% 29.90% 3.32% 6.22% NA
VI/Aromatic  96 3.10% 1.00% 3.12% 92.71% NA
Intermediate  90 38.90% 4.40% 3.33% 53.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0807399839 G -> A LOC_Os08g12500.1 intron_variant ; MODIFIER silent_mutation Average:5.692; most accessible tissue: Minghui63 flower, score: 10.335 N N N N
vg0807399839 G -> DEL N N silent_mutation Average:5.692; most accessible tissue: Minghui63 flower, score: 10.335 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0807399839 NA 2.68E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807399839 NA 5.84E-07 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807399839 NA 7.71E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807399839 NA 4.81E-07 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807399839 NA 4.98E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807399839 NA 8.29E-08 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807399839 NA 2.02E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807399839 NA 6.39E-06 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807399839 NA 4.26E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807399839 NA 4.29E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807399839 NA 5.59E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807399839 NA 1.09E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807399839 NA 1.63E-06 mr1177_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807399839 NA 1.50E-10 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807399839 NA 3.26E-11 mr1183_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807399839 NA 7.86E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807399839 NA 9.42E-06 mr1289_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807399839 NA 5.25E-07 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807399839 NA 6.50E-06 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807399839 NA 1.46E-09 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251