\
| Variant ID: vg0807394143 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr08 | Position: 7394143 |
| Reference Allele: T | Alternative Allele: C,TAATCTTGTC |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 254. )
CTTTCGGGTTGAGCTGCATCGGTTTCAATCTTCAACTGGAGGTAAAGCTTGTTATGGTGGCTTGCGTTCTCGGGATTAGTGCTTCCATCTTTATGATACT[T/C,TAATCTTGTC]
TAATCTTGTTTATATAATTCGTCGAGTTATCGTATACTCTATATAATCTCCGACAATACTATTATTTAACCTTCAATTGGCTAACATCTATCATTGGAAG
CTTCCAATGATAGATGTTAGCCAATTGAAGGTTAAATAATAGTATTGTCGGAGATTATATAGAGTATACGATAACTCGACGAATTATATAAACAAGATTA[A/G,GACAAGATTA]
AGTATCATAAAGATGGAAGCACTAATCCCGAGAACGCAAGCCACCATAACAAGCTTTACCTCCAGTTGAAGATTGAAACCGATGCAGCTCAACCCGAAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.30% | 33.90% | 0.80% | 20.99% | NA |
| All Indica | 2759 | 49.90% | 13.80% | 1.23% | 35.01% | NA |
| All Japonica | 1512 | 21.30% | 77.80% | 0.13% | 0.79% | NA |
| Aus | 269 | 98.50% | 1.10% | 0.00% | 0.37% | NA |
| Indica I | 595 | 22.50% | 35.30% | 1.51% | 40.67% | NA |
| Indica II | 465 | 57.60% | 11.60% | 0.43% | 30.32% | NA |
| Indica III | 913 | 57.50% | 1.40% | 1.31% | 39.76% | NA |
| Indica Intermediate | 786 | 57.40% | 13.20% | 1.40% | 27.99% | NA |
| Temperate Japonica | 767 | 36.40% | 62.10% | 0.26% | 1.30% | NA |
| Tropical Japonica | 504 | 4.00% | 96.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 9.50% | 89.60% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 43.30% | 2.22% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0807394143 | T -> C | LOC_Os08g12500.1 | upstream_gene_variant ; 2660.0bp to feature; MODIFIER | silent_mutation | Average:40.392; most accessible tissue: Minghui63 flag leaf, score: 86.0 | N | N | N | N |
| vg0807394143 | T -> C | LOC_Os08g12490-LOC_Os08g12500 | intergenic_region ; MODIFIER | silent_mutation | Average:40.392; most accessible tissue: Minghui63 flag leaf, score: 86.0 | N | N | N | N |
| vg0807394143 | T -> TAATCTTGTC | LOC_Os08g12500.1 | upstream_gene_variant ; 2659.0bp to feature; MODIFIER | N | Average:40.392; most accessible tissue: Minghui63 flag leaf, score: 86.0 | N | N | N | N |
| vg0807394143 | T -> TAATCTTGTC | LOC_Os08g12490-LOC_Os08g12500 | intergenic_region ; MODIFIER | N | Average:40.392; most accessible tissue: Minghui63 flag leaf, score: 86.0 | N | N | N | N |
| vg0807394143 | T -> DEL | N | N | silent_mutation | Average:40.392; most accessible tissue: Minghui63 flag leaf, score: 86.0 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0807394143 | NA | 4.77E-08 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807394143 | 4.76E-06 | 1.44E-06 | mr1175_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807394143 | NA | 1.08E-06 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |