\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807394143:

Variant ID: vg0807394143 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 7394143
Reference Allele: TAlternative Allele: C,TAATCTTGTC
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTCGGGTTGAGCTGCATCGGTTTCAATCTTCAACTGGAGGTAAAGCTTGTTATGGTGGCTTGCGTTCTCGGGATTAGTGCTTCCATCTTTATGATACT[T/C,TAATCTTGTC]
TAATCTTGTTTATATAATTCGTCGAGTTATCGTATACTCTATATAATCTCCGACAATACTATTATTTAACCTTCAATTGGCTAACATCTATCATTGGAAG

Reverse complement sequence

CTTCCAATGATAGATGTTAGCCAATTGAAGGTTAAATAATAGTATTGTCGGAGATTATATAGAGTATACGATAACTCGACGAATTATATAAACAAGATTA[A/G,GACAAGATTA]
AGTATCATAAAGATGGAAGCACTAATCCCGAGAACGCAAGCCACCATAACAAGCTTTACCTCCAGTTGAAGATTGAAACCGATGCAGCTCAACCCGAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.30% 33.90% 0.80% 20.99% NA
All Indica  2759 49.90% 13.80% 1.23% 35.01% NA
All Japonica  1512 21.30% 77.80% 0.13% 0.79% NA
Aus  269 98.50% 1.10% 0.00% 0.37% NA
Indica I  595 22.50% 35.30% 1.51% 40.67% NA
Indica II  465 57.60% 11.60% 0.43% 30.32% NA
Indica III  913 57.50% 1.40% 1.31% 39.76% NA
Indica Intermediate  786 57.40% 13.20% 1.40% 27.99% NA
Temperate Japonica  767 36.40% 62.10% 0.26% 1.30% NA
Tropical Japonica  504 4.00% 96.00% 0.00% 0.00% NA
Japonica Intermediate  241 9.50% 89.60% 0.00% 0.83% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 40.00% 43.30% 2.22% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0807394143 T -> C LOC_Os08g12500.1 upstream_gene_variant ; 2660.0bp to feature; MODIFIER silent_mutation Average:40.392; most accessible tissue: Minghui63 flag leaf, score: 86.0 N N N N
vg0807394143 T -> C LOC_Os08g12490-LOC_Os08g12500 intergenic_region ; MODIFIER silent_mutation Average:40.392; most accessible tissue: Minghui63 flag leaf, score: 86.0 N N N N
vg0807394143 T -> TAATCTTGTC LOC_Os08g12500.1 upstream_gene_variant ; 2659.0bp to feature; MODIFIER N Average:40.392; most accessible tissue: Minghui63 flag leaf, score: 86.0 N N N N
vg0807394143 T -> TAATCTTGTC LOC_Os08g12490-LOC_Os08g12500 intergenic_region ; MODIFIER N Average:40.392; most accessible tissue: Minghui63 flag leaf, score: 86.0 N N N N
vg0807394143 T -> DEL N N silent_mutation Average:40.392; most accessible tissue: Minghui63 flag leaf, score: 86.0 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0807394143 NA 4.77E-08 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807394143 4.76E-06 1.44E-06 mr1175_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807394143 NA 1.08E-06 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251