\
| Variant ID: vg0807272103 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 7272103 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, A: 0.13, others allele: 0.00, population size: 111. )
CTCCGCATTCCATGGCCTTGGAACCCGTCGTAAACATGTGACATAACCCTTCACCCATCCTAGCCGTAAACAAAAGTACCGACCCAACCCTGCCTACGGC[C/A]
GATATCCCGGGACAGGCAGGCCAGGATTGAGCCCCTAGCAACAGGATCTAGACCGGGTGCGCCACACCCATAGGGGTGAGACCACCCGTGTACTAGTCCA
TGGACTAGTACACGGGTGGTCTCACCCCTATGGGTGTGGCGCACCCGGTCTAGATCCTGTTGCTAGGGGCTCAATCCTGGCCTGCCTGTCCCGGGATATC[G/T]
GCCGTAGGCAGGGTTGGGTCGGTACTTTTGTTTACGGCTAGGATGGGTGAAGGGTTATGTCACATGTTTACGACGGGTTCCAAGGCCATGGAATGCGGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.30% | 24.20% | 4.68% | 28.82% | NA |
| All Indica | 2759 | 17.50% | 26.80% | 7.87% | 47.84% | NA |
| All Japonica | 1512 | 96.90% | 1.70% | 0.13% | 1.32% | NA |
| Aus | 269 | 1.50% | 97.40% | 0.00% | 1.12% | NA |
| Indica I | 595 | 10.30% | 12.30% | 5.21% | 72.27% | NA |
| Indica II | 465 | 13.30% | 46.20% | 6.02% | 34.41% | NA |
| Indica III | 913 | 23.20% | 21.90% | 11.17% | 43.70% | NA |
| Indica Intermediate | 786 | 18.70% | 32.10% | 7.12% | 42.11% | NA |
| Temperate Japonica | 767 | 97.50% | 0.50% | 0.00% | 1.96% | NA |
| Tropical Japonica | 504 | 96.20% | 3.00% | 0.20% | 0.60% | NA |
| Japonica Intermediate | 241 | 96.30% | 2.50% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 4.20% | 94.80% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 48.90% | 28.90% | 2.22% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0807272103 | C -> A | LOC_Os08g12350.1 | upstream_gene_variant ; 1904.0bp to feature; MODIFIER | silent_mutation | Average:24.184; most accessible tissue: Minghui63 flag leaf, score: 61.214 | N | N | N | N |
| vg0807272103 | C -> A | LOC_Os08g12330.1 | downstream_gene_variant ; 4712.0bp to feature; MODIFIER | silent_mutation | Average:24.184; most accessible tissue: Minghui63 flag leaf, score: 61.214 | N | N | N | N |
| vg0807272103 | C -> A | LOC_Os08g12340.1 | downstream_gene_variant ; 791.0bp to feature; MODIFIER | silent_mutation | Average:24.184; most accessible tissue: Minghui63 flag leaf, score: 61.214 | N | N | N | N |
| vg0807272103 | C -> A | LOC_Os08g12340-LOC_Os08g12350 | intergenic_region ; MODIFIER | silent_mutation | Average:24.184; most accessible tissue: Minghui63 flag leaf, score: 61.214 | N | N | N | N |
| vg0807272103 | C -> DEL | N | N | silent_mutation | Average:24.184; most accessible tissue: Minghui63 flag leaf, score: 61.214 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0807272103 | 7.73E-06 | NA | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807272103 | NA | 7.01E-06 | mr1511_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807272103 | NA | 8.73E-07 | mr1583_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807272103 | 7.51E-06 | 3.72E-06 | mr1752_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |