Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0807272103:

Variant ID: vg0807272103 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 7272103
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, A: 0.13, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

CTCCGCATTCCATGGCCTTGGAACCCGTCGTAAACATGTGACATAACCCTTCACCCATCCTAGCCGTAAACAAAAGTACCGACCCAACCCTGCCTACGGC[C/A]
GATATCCCGGGACAGGCAGGCCAGGATTGAGCCCCTAGCAACAGGATCTAGACCGGGTGCGCCACACCCATAGGGGTGAGACCACCCGTGTACTAGTCCA

Reverse complement sequence

TGGACTAGTACACGGGTGGTCTCACCCCTATGGGTGTGGCGCACCCGGTCTAGATCCTGTTGCTAGGGGCTCAATCCTGGCCTGCCTGTCCCGGGATATC[G/T]
GCCGTAGGCAGGGTTGGGTCGGTACTTTTGTTTACGGCTAGGATGGGTGAAGGGTTATGTCACATGTTTACGACGGGTTCCAAGGCCATGGAATGCGGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.30%	24.20%	4.68%	28.82%	NA
All Indica	2759	17.50%	26.80%	7.87%	47.84%	NA
All Japonica	1512	96.90%	1.70%	0.13%	1.32%	NA
Aus	269	1.50%	97.40%	0.00%	1.12%	NA
Indica I	595	10.30%	12.30%	5.21%	72.27%	NA
Indica II	465	13.30%	46.20%	6.02%	34.41%	NA
Indica III	913	23.20%	21.90%	11.17%	43.70%	NA
Indica Intermediate	786	18.70%	32.10%	7.12%	42.11%	NA
Temperate Japonica	767	97.50%	0.50%	0.00%	1.96%	NA
Tropical Japonica	504	96.20%	3.00%	0.20%	0.60%	NA
Japonica Intermediate	241	96.30%	2.50%	0.41%	0.83%	NA
VI/Aromatic	96	4.20%	94.80%	0.00%	1.04%	NA
Intermediate	90	48.90%	28.90%	2.22%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0807272103	C -> A	LOC_Os08g12350.1	upstream_gene_variant ; 1904.0bp to feature; MODIFIER	silent_mutation	Average:24.184; most accessible tissue: Minghui63 flag leaf, score: 61.214	N	N	N	N
vg0807272103	C -> A	LOC_Os08g12330.1	downstream_gene_variant ; 4712.0bp to feature; MODIFIER	silent_mutation	Average:24.184; most accessible tissue: Minghui63 flag leaf, score: 61.214	N	N	N	N
vg0807272103	C -> A	LOC_Os08g12340.1	downstream_gene_variant ; 791.0bp to feature; MODIFIER	silent_mutation	Average:24.184; most accessible tissue: Minghui63 flag leaf, score: 61.214	N	N	N	N
vg0807272103	C -> A	LOC_Os08g12340-LOC_Os08g12350	intergenic_region ; MODIFIER	silent_mutation	Average:24.184; most accessible tissue: Minghui63 flag leaf, score: 61.214	N	N	N	N
vg0807272103	C -> DEL	N	N	silent_mutation	Average:24.184; most accessible tissue: Minghui63 flag leaf, score: 61.214	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0807272103	7.73E-06	NA	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807272103	NA	7.01E-06	mr1511_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807272103	NA	8.73E-07	mr1583_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807272103	7.51E-06	3.72E-06	mr1752_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251