\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807272103:

Variant ID: vg0807272103 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 7272103
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, A: 0.13, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


CTCCGCATTCCATGGCCTTGGAACCCGTCGTAAACATGTGACATAACCCTTCACCCATCCTAGCCGTAAACAAAAGTACCGACCCAACCCTGCCTACGGC[C/A]
GATATCCCGGGACAGGCAGGCCAGGATTGAGCCCCTAGCAACAGGATCTAGACCGGGTGCGCCACACCCATAGGGGTGAGACCACCCGTGTACTAGTCCA

Reverse complement sequence

TGGACTAGTACACGGGTGGTCTCACCCCTATGGGTGTGGCGCACCCGGTCTAGATCCTGTTGCTAGGGGCTCAATCCTGGCCTGCCTGTCCCGGGATATC[G/T]
GCCGTAGGCAGGGTTGGGTCGGTACTTTTGTTTACGGCTAGGATGGGTGAAGGGTTATGTCACATGTTTACGACGGGTTCCAAGGCCATGGAATGCGGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.30% 24.20% 4.68% 28.82% NA
All Indica  2759 17.50% 26.80% 7.87% 47.84% NA
All Japonica  1512 96.90% 1.70% 0.13% 1.32% NA
Aus  269 1.50% 97.40% 0.00% 1.12% NA
Indica I  595 10.30% 12.30% 5.21% 72.27% NA
Indica II  465 13.30% 46.20% 6.02% 34.41% NA
Indica III  913 23.20% 21.90% 11.17% 43.70% NA
Indica Intermediate  786 18.70% 32.10% 7.12% 42.11% NA
Temperate Japonica  767 97.50% 0.50% 0.00% 1.96% NA
Tropical Japonica  504 96.20% 3.00% 0.20% 0.60% NA
Japonica Intermediate  241 96.30% 2.50% 0.41% 0.83% NA
VI/Aromatic  96 4.20% 94.80% 0.00% 1.04% NA
Intermediate  90 48.90% 28.90% 2.22% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0807272103 C -> A LOC_Os08g12350.1 upstream_gene_variant ; 1904.0bp to feature; MODIFIER silent_mutation Average:24.184; most accessible tissue: Minghui63 flag leaf, score: 61.214 N N N N
vg0807272103 C -> A LOC_Os08g12330.1 downstream_gene_variant ; 4712.0bp to feature; MODIFIER silent_mutation Average:24.184; most accessible tissue: Minghui63 flag leaf, score: 61.214 N N N N
vg0807272103 C -> A LOC_Os08g12340.1 downstream_gene_variant ; 791.0bp to feature; MODIFIER silent_mutation Average:24.184; most accessible tissue: Minghui63 flag leaf, score: 61.214 N N N N
vg0807272103 C -> A LOC_Os08g12340-LOC_Os08g12350 intergenic_region ; MODIFIER silent_mutation Average:24.184; most accessible tissue: Minghui63 flag leaf, score: 61.214 N N N N
vg0807272103 C -> DEL N N silent_mutation Average:24.184; most accessible tissue: Minghui63 flag leaf, score: 61.214 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0807272103 7.73E-06 NA mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807272103 NA 7.01E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807272103 NA 8.73E-07 mr1583_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807272103 7.51E-06 3.72E-06 mr1752_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251