\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807262913:

Variant ID: vg0807262913 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 7262913
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.53, C: 0.46, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


AATATTAGAAGAGGAGACTAGAGTCCATATAGAAATACAATTAGGAAATAACTGAATTTCAGAATTAAAAATAAGGAATATTAGAAGTAGAGTATATAGT[T/C]
CATATAGAAATACAATTAGGAAATAATAGAAATTCGGATTTAAAAGTAAGAAATATTAGAAGTAGAGTATAGAGTCCATATAGAAATACAATTAAGAAAA

Reverse complement sequence

TTTTCTTAATTGTATTTCTATATGGACTCTATACTCTACTTCTAATATTTCTTACTTTTAAATCCGAATTTCTATTATTTCCTAATTGTATTTCTATATG[A/G]
ACTATATACTCTACTTCTAATATTCCTTATTTTTAATTCTGAAATTCAGTTATTTCCTAATTGTATTTCTATATGGACTCTAGTCTCCTCTTCTAATATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.40% 29.50% 0.55% 34.62% NA
All Indica  2759 5.40% 36.20% 0.69% 57.70% NA
All Japonica  1512 97.00% 1.50% 0.13% 1.39% NA
Aus  269 4.50% 93.30% 1.49% 0.74% NA
Indica I  595 6.10% 11.60% 0.84% 81.51% NA
Indica II  465 7.50% 50.30% 0.65% 41.51% NA
Indica III  913 2.60% 40.70% 0.11% 56.52% NA
Indica Intermediate  786 7.00% 41.10% 1.27% 50.64% NA
Temperate Japonica  767 97.40% 0.40% 0.13% 2.09% NA
Tropical Japonica  504 96.60% 2.80% 0.20% 0.40% NA
Japonica Intermediate  241 96.30% 2.50% 0.00% 1.24% NA
VI/Aromatic  96 6.20% 91.70% 1.04% 1.04% NA
Intermediate  90 41.10% 36.70% 0.00% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0807262913 T -> C LOC_Os08g12330.1 upstream_gene_variant ; 1859.0bp to feature; MODIFIER silent_mutation Average:14.616; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0807262913 T -> C LOC_Os08g12320.1 downstream_gene_variant ; 3974.0bp to feature; MODIFIER silent_mutation Average:14.616; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0807262913 T -> C LOC_Os08g12320-LOC_Os08g12330 intergenic_region ; MODIFIER silent_mutation Average:14.616; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0807262913 T -> DEL N N silent_mutation Average:14.616; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0807262913 NA 2.48E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807262913 NA 1.28E-44 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807262913 NA 3.48E-35 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807262913 NA 1.23E-21 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807262913 NA 5.14E-34 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807262913 NA 6.54E-33 mr1102_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807262913 NA 1.39E-31 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807262913 NA 1.06E-52 mr1194_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807262913 NA 7.46E-35 mr1223_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807262913 NA 1.59E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807262913 NA 3.37E-13 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807262913 1.55E-10 NA mr1334_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807262913 NA 2.14E-24 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807262913 NA 5.14E-19 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807262913 NA 4.17E-50 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807262913 NA 5.46E-15 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807262913 NA 2.91E-16 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807262913 NA 2.33E-24 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807262913 NA 9.17E-33 mr1780_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807262913 NA 7.00E-24 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807262913 2.18E-06 1.44E-55 mr1991_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251