\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807204233:

Variant ID: vg0807204233 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 7204233
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAAGCTTTATAGTTTTATTTAACTCCTTCGACTGTAACTTTGTAAATATTTTTTGAGTTATATAAAATTACACTGCTCGGCAAAGCCCTGGCAGTATTT[C/T]
AGGTCAAAAAAGATTTCATATAGATTGAAACGACAAACCAATCGACGTCAGAGATTAGAATCATCGATCTCATTGAGATTGCCCTCGAGCAAAAACAATG

Reverse complement sequence

CATTGTTTTTGCTCGAGGGCAATCTCAATGAGATCGATGATTCTAATCTCTGACGTCGATTGGTTTGTCGTTTCAATCTATATGAAATCTTTTTTGACCT[G/A]
AAATACTGCCAGGGCTTTGCCGAGCAGTGTAATTTTATATAACTCAAAAAATATTTACAAAGTTACAGTCGAAGGAGTTAAATAAAACTATAAAGCTTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.80% 2.70% 0.70% 0.78% NA
All Indica  2759 99.70% 0.00% 0.22% 0.00% NA
All Japonica  1512 88.00% 8.00% 1.52% 2.45% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.00% 0.51% 0.00% NA
Temperate Japonica  767 93.60% 0.40% 1.17% 4.82% NA
Tropical Japonica  504 88.50% 10.50% 0.99% 0.00% NA
Japonica Intermediate  241 69.30% 27.00% 3.73% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 91.10% 4.40% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0807204233 C -> T LOC_Os08g12230.1 3_prime_UTR_variant ; 1194.0bp to feature; MODIFIER silent_mutation Average:25.299; most accessible tissue: Minghui63 flag leaf, score: 44.406 N N N N
vg0807204233 C -> T LOC_Os08g12220.1 upstream_gene_variant ; 2472.0bp to feature; MODIFIER silent_mutation Average:25.299; most accessible tissue: Minghui63 flag leaf, score: 44.406 N N N N
vg0807204233 C -> T LOC_Os08g12240.1 downstream_gene_variant ; 1832.0bp to feature; MODIFIER silent_mutation Average:25.299; most accessible tissue: Minghui63 flag leaf, score: 44.406 N N N N
vg0807204233 C -> T LOC_Os08g12250.1 downstream_gene_variant ; 3949.0bp to feature; MODIFIER silent_mutation Average:25.299; most accessible tissue: Minghui63 flag leaf, score: 44.406 N N N N
vg0807204233 C -> DEL N N silent_mutation Average:25.299; most accessible tissue: Minghui63 flag leaf, score: 44.406 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0807204233 NA 9.21E-07 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807204233 NA 8.90E-06 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807204233 1.02E-06 3.39E-08 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807204233 9.03E-08 5.86E-09 mr1119 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807204233 NA 7.54E-06 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807204233 7.32E-06 1.70E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807204233 NA 2.01E-07 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807204233 NA 5.28E-06 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807204233 7.25E-06 3.64E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807204233 3.65E-06 3.04E-09 mr1961 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807204233 6.85E-07 9.17E-08 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807204233 4.14E-06 7.72E-07 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807204233 NA 3.72E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807204233 NA 2.96E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807204233 7.01E-07 4.97E-08 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807204233 NA 8.18E-06 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807204233 6.31E-07 4.91E-08 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807204233 NA 8.76E-06 mr1595_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807204233 3.42E-06 1.34E-06 mr1961_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251