\
| Variant ID: vg0807184916 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 7184916 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.26, others allele: 0.00, population size: 70. )
GGTTATAGGTAATAGCTTGTATAGATAGAATATGTTTAGGAAATGACTCGGGAATTATGTTAACTTGTATGTCAAGGAAATATCCAGTAGTGCCAGTTAG[C/T]
TACAGTTGTAATACATATTCGTTAGCCTAGTACGTAAGCCATATGGGCTGTACATTGTAATCTTGGCTCCTCTCCCTATATAAGGTCGGGTCTAAGTGTA
TACACTTAGACCCGACCTTATATAGGGAGAGGAGCCAAGATTACAATGTACAGCCCATATGGCTTACGTACTAGGCTAACGAATATGTATTACAACTGTA[G/A]
CTAACTGGCACTACTGGATATTTCCTTGACATACAAGTTAACATAATTCCCGAGTCATTTCCTAAACATATTCTATCTATACAAGCTATTACCTATAACC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.60% | 24.90% | 7.26% | 35.19% | NA |
| All Indica | 2759 | 2.20% | 28.10% | 12.00% | 57.63% | NA |
| All Japonica | 1512 | 95.00% | 1.70% | 0.26% | 3.04% | NA |
| Aus | 269 | 0.00% | 98.10% | 0.74% | 1.12% | NA |
| Indica I | 595 | 1.50% | 13.10% | 1.68% | 83.70% | NA |
| Indica II | 465 | 4.10% | 47.70% | 7.10% | 41.08% | NA |
| Indica III | 913 | 1.10% | 23.30% | 20.59% | 54.98% | NA |
| Indica Intermediate | 786 | 3.10% | 33.50% | 12.72% | 50.76% | NA |
| Temperate Japonica | 767 | 94.00% | 0.40% | 0.39% | 5.22% | NA |
| Tropical Japonica | 504 | 96.00% | 3.20% | 0.20% | 0.60% | NA |
| Japonica Intermediate | 241 | 95.90% | 2.90% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 4.20% | 92.70% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 43.30% | 26.70% | 5.56% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0807184916 | C -> T | LOC_Os08g12190-LOC_Os08g12210 | intergenic_region ; MODIFIER | silent_mutation | Average:12.455; most accessible tissue: Minghui63 young leaf, score: 23.613 | N | N | N | N |
| vg0807184916 | C -> DEL | N | N | silent_mutation | Average:12.455; most accessible tissue: Minghui63 young leaf, score: 23.613 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0807184916 | NA | 2.91E-73 | mr1018 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 2.13E-92 | mr1071 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 4.23E-83 | mr1080 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 3.13E-79 | mr1100 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 1.04E-19 | mr1102 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 1.76E-23 | mr1122 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 8.82E-45 | mr1136 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 1.98E-93 | mr1140 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 1.25E-43 | mr1141 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 1.36E-48 | mr1194 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 3.11E-102 | mr1203 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 2.78E-26 | mr1223 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 9.95E-23 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 4.71E-94 | mr1395 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 1.24E-37 | mr1402 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 1.22E-40 | mr1480 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 4.93E-22 | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 2.83E-24 | mr1588 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 7.98E-80 | mr1613 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 3.37E-96 | mr1618 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 1.37E-67 | mr1619 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 5.15E-13 | mr1641 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 1.18E-50 | mr1692 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 1.75E-06 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | 2.75E-06 | 2.80E-76 | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 4.03E-34 | mr1780 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 3.12E-10 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 6.01E-38 | mr1828 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 6.23E-76 | mr1907 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 6.71E-36 | mr1932 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 5.41E-77 | mr1934 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 1.07E-55 | mr1935 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 8.78E-59 | mr1962 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 2.41E-103 | mr1071_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 1.73E-101 | mr1080_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 4.33E-31 | mr1102_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 1.72E-31 | mr1105_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 6.05E-19 | mr1168_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 5.58E-55 | mr1194_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 5.02E-111 | mr1203_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 3.21E-52 | mr1261_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 1.61E-19 | mr1383_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 4.14E-53 | mr1480_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 7.29E-14 | mr1529_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 4.44E-27 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 2.13E-12 | mr1641_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 6.22E-11 | mr1714_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 6.45E-16 | mr1715_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | 6.62E-07 | 6.28E-77 | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 9.51E-34 | mr1780_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 1.01E-66 | mr1828_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 2.87E-13 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 4.24E-82 | mr1934_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 2.62E-23 | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807184916 | NA | 2.12E-52 | mr1991_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |