Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807147308:

Variant ID: vg0807147308 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 7147308
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

AAACGGCAAGGTCCGGGTGTGCATTGATTTCAGGGATTTAAATAAAGCTACCCCAAAATATGAGTATCCAATGCCAGTAGCCGATCAGCTGGTTGATGCT[A/G]
CCTCAGGACACAAGATTTTAAGTTTTATGGATGGTAATGCAGGATACAATCAAATCTTTATGGCCAAAGAGGATATCCGTAAGACAGCTTTTAGGTGTCC

Reverse complement sequence

GGACACCTAAAAGCTGTCTTACGGATATCCTCTTTGGCCATAAAGATTTGATTGTATCCTGCATTACCATCCATAAAACTTAAAATCTTGTGTCCTGAGG[T/C]
AGCATCAACCAGCTGATCGGCTACTGGCATTGGATACTCATATTTTGGGGTAGCTTTATTTAAATCCCTGAAATCAATGCACACCCGGACCTTGCCGTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.00%	31.90%	2.12%	0.00%	NA
All Indica	2759	98.50%	1.00%	0.47%	0.00%	NA
All Japonica	1512	3.30%	95.20%	1.46%	0.00%	NA
Aus	269	81.80%	0.40%	17.84%	0.00%	NA
Indica I	595	99.20%	0.30%	0.50%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	99.30%	0.20%	0.44%	0.00%	NA
Indica Intermediate	786	97.70%	1.50%	0.76%	0.00%	NA
Temperate Japonica	767	2.70%	94.40%	2.87%	0.00%	NA
Tropical Japonica	504	4.00%	96.00%	0.00%	0.00%	NA
Japonica Intermediate	241	3.70%	96.30%	0.00%	0.00%	NA
VI/Aromatic	96	81.20%	4.20%	14.58%	0.00%	NA
Intermediate	90	58.90%	37.80%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0807147308	A -> G	LOC_Os08g12130.1	missense_variant ; p.Thr829Ala; MODERATE	nonsynonymous_codon ; T829A	Average:36.526; most accessible tissue: Minghui63 flag leaf, score: 55.068	benign	-0.872	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0807147308	3.12E-08	3.02E-79	mr1018	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	2.25E-56	mr1019	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	6.76E-76	mr1100	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	4.53E-20	mr1102	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	7.27E-24	mr1122	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	5.84E-06	NA	mr1132	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	3.88E-44	mr1136	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	2.23E-91	mr1140	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	3.74E-43	mr1141	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	4.48E-06	NA	mr1178	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	3.02E-49	mr1194	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	5.51E-09	mr1198	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	3.23E-95	mr1203	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	1.01E-27	mr1223	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	1.77E-07	NA	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	3.81E-23	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	1.38E-91	mr1395	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	1.35E-36	mr1402	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	5.39E-43	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	6.75E-06	NA	mr1489	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	9.42E-21	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	4.98E-77	mr1613	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	6.40E-93	mr1618	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	1.91E-20	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	8.83E-13	mr1641	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	2.12E-08	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	2.82E-53	mr1692	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	1.20E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	5.40E-06	2.24E-74	mr1778	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	4.85E-35	mr1780	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	1.52E-36	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	2.17E-76	mr1934	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	1.58E-53	mr1935	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	8.93E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	1.52E-07	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	2.89E-30	mr1102_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	2.49E-18	mr1168_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	1.35E-52	mr1261_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	8.99E-20	mr1383_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	1.83E-52	mr1480_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	2.49E-06	NA	mr1489_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	4.25E-06	1.29E-73	mr1778_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	2.73E-33	mr1780_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	1.76E-07	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807147308	NA	8.19E-22	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251