\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807117547:

Variant ID: vg0807117547 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 7117547
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.14, others allele: 0.00, population size: 43. )

Flanking Sequence (100 bp) in Reference Genome:


ACAGAGGAGTGGTTCCTGGAGCAAGATCTATCCGGAACTCAATCTCTCGCTTGGGCGGCATACCGCGTAGTTCTTCCGGAAACACATCTCCGAACTCTCT[A/G]
ACGATGGGGGTTTCCGACAGTCCTATCTGATGAAGTTCTGAACTGCCGACAGAGGTTGAGGGTGCAAAGAAAACAACCGGTTGTTCCGGCCCTCGGTACA

Reverse complement sequence

TGTACCGAGGGCCGGAACAACCGGTTGTTTTCTTTGCACCCTCAACCTCTGTCGGCAGTTCAGAACTTCATCAGATAGGACTGTCGGAAACCCCCATCGT[T/C]
AGAGAGTTCGGAGATGTGTTTCCGGAAGAACTACGCGGTATGCCGCCCAAGCGAGAGATTGAGTTCCGGATAGATCTTGCTCCAGGAACCACTCCTCTGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.90% 11.50% 19.09% 31.53% NA
All Indica  2759 10.50% 17.70% 22.44% 49.29% NA
All Japonica  1512 94.80% 0.30% 1.19% 3.64% NA
Aus  269 7.10% 11.90% 61.71% 19.33% NA
Indica I  595 25.00% 6.60% 12.94% 55.46% NA
Indica II  465 9.70% 23.00% 28.60% 38.71% NA
Indica III  913 1.40% 22.00% 22.34% 54.22% NA
Indica Intermediate  786 10.70% 18.10% 26.08% 45.17% NA
Temperate Japonica  767 93.50% 0.00% 0.39% 6.13% NA
Tropical Japonica  504 96.20% 0.60% 1.98% 1.19% NA
Japonica Intermediate  241 96.30% 0.80% 2.07% 0.83% NA
VI/Aromatic  96 5.20% 10.40% 83.33% 1.04% NA
Intermediate  90 46.70% 7.80% 21.11% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0807117547 A -> G LOC_Os08g12080.1 synonymous_variant ; p.Val739Val; LOW synonymous_codon Average:34.742; most accessible tissue: Minghui63 flag leaf, score: 75.341 N N N N
vg0807117547 A -> G LOC_Os08g12080.1 synonymous_variant ; p.Val739Val; LOW nonsynonymous_codon ; V739L Average:34.742; most accessible tissue: Minghui63 flag leaf, score: 75.341 benign 1.363 DELETERIOUS 0.00
vg0807117547 A -> DEL LOC_Os08g12080.1 N frameshift_variant Average:34.742; most accessible tissue: Minghui63 flag leaf, score: 75.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0807117547 6.38E-08 1.45E-09 mr1100 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807117547 NA 1.61E-89 mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807117547 NA 5.99E-07 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807117547 1.04E-06 6.35E-98 mr1203 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807117547 NA 1.22E-06 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807117547 4.72E-06 2.73E-90 mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807117547 8.87E-06 8.70E-08 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807117547 NA 3.91E-35 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807117547 NA 8.46E-39 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807117547 NA 1.67E-77 mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807117547 3.39E-09 9.31E-12 mr1613 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807117547 NA 1.13E-06 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807117547 2.32E-06 3.06E-07 mr1619 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807117547 NA 2.51E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807117547 NA 3.04E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807117547 NA 3.51E-51 mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807117547 8.54E-08 8.62E-09 mr1962 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807117547 NA 3.23E-50 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807117547 NA 3.72E-22 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251