Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806964414:

Variant ID: vg0806964414 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 6964414
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

CAGCAATGGCGGCCGGTTAGGGTTTGCGAGCTCGCCGGAGCTAGGGCGGTCGACCGGGTGATTGGAGGACACCTACGCGTAGAGGACATCGAGACGAACC[T/C]
GATGGTACTCACCCGGACTTCAAACGATGAACGACGACGGCCGGAGACGAGGAGCACGGCGGCGGCGGTTCGGGTTGACGGCGACGGCGAGCTACGGCGG

Reverse complement sequence

CCGCCGTAGCTCGCCGTCGCCGTCAACCCGAACCGCCGCCGCCGTGCTCCTCGTCTCCGGCCGTCGTCGTTCATCGTTTGAAGTCCGGGTGAGTACCATC[A/G]
GGTTCGTCTCGATGTCCTCTACGCGTAGGTGTCCTCCAATCACCCGGTCGACCGCCCTAGCTCCGGCGAGCTCGCAAACCCTAACCGGCCGCCATTGCTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.20%	3.40%	12.15%	17.29%	NA
All Indica	2759	60.30%	0.60%	16.78%	22.36%	NA
All Japonica	1512	83.70%	9.50%	2.05%	4.83%	NA
Aus	269	53.20%	0.00%	24.16%	22.68%	NA
Indica I	595	71.90%	1.30%	12.44%	14.29%	NA
Indica II	465	64.10%	0.40%	10.54%	24.95%	NA
Indica III	913	49.90%	0.10%	22.78%	27.16%	NA
Indica Intermediate	786	61.20%	0.60%	16.79%	21.37%	NA
Temperate Japonica	767	73.00%	18.30%	3.00%	5.74%	NA
Tropical Japonica	504	96.80%	0.20%	0.60%	2.38%	NA
Japonica Intermediate	241	90.00%	0.80%	2.07%	7.05%	NA
VI/Aromatic	96	46.90%	0.00%	7.29%	45.83%	NA
Intermediate	90	66.70%	0.00%	8.89%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0806964414	T -> C	LOC_Os08g11870.1	upstream_gene_variant ; 2411.0bp to feature; MODIFIER	silent_mutation	Average:70.454; most accessible tissue: Minghui63 flag leaf, score: 90.593	N	N	N	N
vg0806964414	T -> C	LOC_Os08g11890.1	upstream_gene_variant ; 3327.0bp to feature; MODIFIER	silent_mutation	Average:70.454; most accessible tissue: Minghui63 flag leaf, score: 90.593	N	N	N	N
vg0806964414	T -> C	LOC_Os08g11880.1	downstream_gene_variant ; 966.0bp to feature; MODIFIER	silent_mutation	Average:70.454; most accessible tissue: Minghui63 flag leaf, score: 90.593	N	N	N	N
vg0806964414	T -> C	LOC_Os08g11870-LOC_Os08g11880	intergenic_region ; MODIFIER	silent_mutation	Average:70.454; most accessible tissue: Minghui63 flag leaf, score: 90.593	N	N	N	N
vg0806964414	T -> DEL	N	N	silent_mutation	Average:70.454; most accessible tissue: Minghui63 flag leaf, score: 90.593	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0806964414	T	C	0.01	0.01	0.01	0.01	0.01	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0806964414	NA	9.77E-14	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414	4.77E-06	NA	mr1080	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414	3.74E-06	NA	mr1203	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414	7.10E-06	1.37E-29	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414	NA	7.84E-18	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414	NA	5.42E-06	mr1517	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414	NA	6.91E-12	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414	NA	4.19E-17	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414	NA	5.15E-11	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414	NA	1.07E-09	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414	NA	2.49E-20	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414	NA	5.53E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414	NA	1.04E-19	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414	NA	4.39E-18	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251