\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806964414:

Variant ID: vg0806964414 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 6964414
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


CAGCAATGGCGGCCGGTTAGGGTTTGCGAGCTCGCCGGAGCTAGGGCGGTCGACCGGGTGATTGGAGGACACCTACGCGTAGAGGACATCGAGACGAACC[T/C]
GATGGTACTCACCCGGACTTCAAACGATGAACGACGACGGCCGGAGACGAGGAGCACGGCGGCGGCGGTTCGGGTTGACGGCGACGGCGAGCTACGGCGG

Reverse complement sequence

CCGCCGTAGCTCGCCGTCGCCGTCAACCCGAACCGCCGCCGCCGTGCTCCTCGTCTCCGGCCGTCGTCGTTCATCGTTTGAAGTCCGGGTGAGTACCATC[A/G]
GGTTCGTCTCGATGTCCTCTACGCGTAGGTGTCCTCCAATCACCCGGTCGACCGCCCTAGCTCCGGCGAGCTCGCAAACCCTAACCGGCCGCCATTGCTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.20% 3.40% 12.15% 17.29% NA
All Indica  2759 60.30% 0.60% 16.78% 22.36% NA
All Japonica  1512 83.70% 9.50% 2.05% 4.83% NA
Aus  269 53.20% 0.00% 24.16% 22.68% NA
Indica I  595 71.90% 1.30% 12.44% 14.29% NA
Indica II  465 64.10% 0.40% 10.54% 24.95% NA
Indica III  913 49.90% 0.10% 22.78% 27.16% NA
Indica Intermediate  786 61.20% 0.60% 16.79% 21.37% NA
Temperate Japonica  767 73.00% 18.30% 3.00% 5.74% NA
Tropical Japonica  504 96.80% 0.20% 0.60% 2.38% NA
Japonica Intermediate  241 90.00% 0.80% 2.07% 7.05% NA
VI/Aromatic  96 46.90% 0.00% 7.29% 45.83% NA
Intermediate  90 66.70% 0.00% 8.89% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0806964414 T -> C LOC_Os08g11870.1 upstream_gene_variant ; 2411.0bp to feature; MODIFIER silent_mutation Average:70.454; most accessible tissue: Minghui63 flag leaf, score: 90.593 N N N N
vg0806964414 T -> C LOC_Os08g11890.1 upstream_gene_variant ; 3327.0bp to feature; MODIFIER silent_mutation Average:70.454; most accessible tissue: Minghui63 flag leaf, score: 90.593 N N N N
vg0806964414 T -> C LOC_Os08g11880.1 downstream_gene_variant ; 966.0bp to feature; MODIFIER silent_mutation Average:70.454; most accessible tissue: Minghui63 flag leaf, score: 90.593 N N N N
vg0806964414 T -> C LOC_Os08g11870-LOC_Os08g11880 intergenic_region ; MODIFIER silent_mutation Average:70.454; most accessible tissue: Minghui63 flag leaf, score: 90.593 N N N N
vg0806964414 T -> DEL N N silent_mutation Average:70.454; most accessible tissue: Minghui63 flag leaf, score: 90.593 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0806964414 T C 0.01 0.01 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0806964414 NA 9.77E-14 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414 4.77E-06 NA mr1080 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414 3.74E-06 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414 7.10E-06 1.37E-29 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414 NA 7.84E-18 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414 NA 5.42E-06 mr1517 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414 NA 6.91E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414 NA 4.19E-17 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414 NA 5.15E-11 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414 NA 1.07E-09 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414 NA 2.49E-20 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414 NA 5.53E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414 NA 1.04E-19 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806964414 NA 4.39E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251