\
| Variant ID: vg0806948099 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 6948099 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCCGGAACGTCGGAAACTAAAGCAATTAAACAAAAATCAACAAAACAGTACAAAAACAAGCATAAACAGTACATGTGGATAATTTTAACATGTAGATCTT[A/G]
ATTTTAGAAAAATTTAGCAACTTGAACTACCTGAAACGGATCTACGGTTATTTAGTTATGATTTTCCGAAGTTTTAATCTATTAGAAAATCGGAAAAAAG
CTTTTTTCCGATTTTCTAATAGATTAAAACTTCGGAAAATCATAACTAAATAACCGTAGATCCGTTTCAGGTAGTTCAAGTTGCTAAATTTTTCTAAAAT[T/C]
AAGATCTACATGTTAAAATTATCCACATGTACTGTTTATGCTTGTTTTTGTACTGTTTTGTTGATTTTTGTTTAATTGCTTTAGTTTCCGACGTTCCGGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.40% | 1.60% | 13.27% | 23.66% | NA |
| All Indica | 2759 | 48.00% | 0.10% | 17.04% | 34.90% | NA |
| All Japonica | 1512 | 87.70% | 4.90% | 1.46% | 5.95% | NA |
| Aus | 269 | 54.60% | 0.00% | 42.01% | 3.35% | NA |
| Indica I | 595 | 60.30% | 0.20% | 7.73% | 31.76% | NA |
| Indica II | 465 | 49.00% | 0.00% | 14.84% | 36.13% | NA |
| Indica III | 913 | 38.30% | 0.00% | 23.22% | 38.44% | NA |
| Indica Intermediate | 786 | 49.10% | 0.30% | 18.19% | 32.44% | NA |
| Temperate Japonica | 767 | 81.20% | 9.60% | 1.43% | 7.69% | NA |
| Tropical Japonica | 504 | 95.60% | 0.00% | 1.98% | 2.38% | NA |
| Japonica Intermediate | 241 | 91.70% | 0.00% | 0.41% | 7.88% | NA |
| VI/Aromatic | 96 | 53.10% | 0.00% | 11.46% | 35.42% | NA |
| Intermediate | 90 | 63.30% | 0.00% | 12.22% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0806948099 | A -> G | LOC_Os08g11850.1 | downstream_gene_variant ; 1227.0bp to feature; MODIFIER | silent_mutation | Average:30.833; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0806948099 | A -> G | LOC_Os08g11840-LOC_Os08g11850 | intergenic_region ; MODIFIER | silent_mutation | Average:30.833; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0806948099 | A -> DEL | N | N | silent_mutation | Average:30.833; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0806948099 | NA | 1.42E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806948099 | 2.01E-06 | 3.25E-06 | mr1517 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806948099 | 2.68E-06 | NA | mr1844 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806948099 | NA | 2.53E-13 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806948099 | NA | 1.96E-10 | mr1905 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806948099 | NA | 2.08E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806948099 | NA | 5.82E-08 | mr1004_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806948099 | NA | 2.82E-08 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806948099 | NA | 3.90E-07 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806948099 | NA | 5.84E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806948099 | NA | 1.23E-13 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806948099 | NA | 3.00E-06 | mr1928_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |