Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806942341:

Variant ID: vg0806942341 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 6942341
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCCACGGCAAACGCCAAAAGAAAACTACCAAATCTAAAGAGCGGGCGGAGGGCCTCACACCTCTGGGTGATCTTGGGCATCGCCTCCACCCTCTTCGGC[C/T]
GCCGGCTCTTCGTCCTAGTTCGCCGCCTCCGCCTTCGCCAAGTGTTCAAGCAGACGCGCCTTAGCAGTGGATCGGCCGTCCTTTTGCCAGAACTGTTTGC

Reverse complement sequence

GCAAACAGTTCTGGCAAAAGGACGGCCGATCCACTGCTAAGGCGCGTCTGCTTGAACACTTGGCGAAGGCGGAGGCGGCGAACTAGGACGAAGAGCCGGC[G/A]
GCCGAAGAGGGTGGAGGCGATGCCCAAGATCACCCAGAGGTGTGAGGCCCTCCGCCCGCTCTTTAGATTTGGTAGTTTTCTTTTGGCGTTTGCCGTGGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.50%	23.50%	2.07%	22.96%	NA
All Indica	2759	34.50%	25.80%	3.01%	36.61%	NA
All Japonica	1512	92.90%	2.60%	0.79%	3.77%	NA
Aus	269	6.70%	91.40%	0.74%	1.12%	NA
Indica I	595	56.10%	11.10%	1.68%	31.09%	NA
Indica II	465	24.10%	42.80%	3.44%	29.68%	NA
Indica III	913	22.90%	23.00%	3.18%	50.93%	NA
Indica Intermediate	786	37.90%	30.30%	3.56%	28.24%	NA
Temperate Japonica	767	92.20%	1.80%	1.30%	4.69%	NA
Tropical Japonica	504	95.20%	3.20%	0.20%	1.39%	NA
Japonica Intermediate	241	90.00%	3.70%	0.41%	5.81%	NA
VI/Aromatic	96	11.50%	87.50%	1.04%	0.00%	NA
Intermediate	90	52.20%	31.10%	0.00%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0806942341	C -> T	LOC_Os08g11830.1	upstream_gene_variant ; 4729.0bp to feature; MODIFIER	silent_mutation	Average:15.934; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0806942341	C -> T	LOC_Os08g11840.1	downstream_gene_variant ; 15.0bp to feature; MODIFIER	silent_mutation	Average:15.934; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0806942341	C -> T	LOC_Os08g11830-LOC_Os08g11840	intergenic_region ; MODIFIER	silent_mutation	Average:15.934; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0806942341	C -> DEL	N	N	silent_mutation	Average:15.934; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0806942341	NA	3.15E-42	mr1136	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806942341	NA	2.77E-22	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806942341	NA	3.61E-31	mr1105_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806942341	NA	4.27E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806942341	NA	7.69E-53	mr1194_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806942341	NA	1.31E-08	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806942341	NA	2.21E-10	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806942341	NA	7.22E-12	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806942341	NA	3.36E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806942341	NA	4.04E-06	mr1510_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806942341	NA	3.19E-16	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806942341	NA	1.11E-11	mr1641_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806942341	NA	8.26E-11	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806942341	NA	8.35E-15	mr1767_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806942341	NA	2.64E-13	mr1838_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806942341	NA	9.70E-09	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806942341	NA	2.52E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806942341	NA	4.17E-23	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251