\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806865309:

Variant ID: vg0806865309 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 6865309
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: Unkown

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGACCCATGTGTCATCCAATCACAGCCAACATACCATCCACTCATCTCTCTTTTAATCTTTCTTTTATTTCTCAAAAGGTGAGATAAGGGTTAAAATA[C/T]
AATTCTCACCATATAATTTACATTACTACTCACACATGCCTAGAGTACATCTTCATGGGCCCTTTAGTAATTCACATGCAACCAATCAACATTAGTTAAT

Reverse complement sequence

ATTAACTAATGTTGATTGGTTGCATGTGAATTACTAAAGGGCCCATGAAGATGTACTCTAGGCATGTGTGAGTAGTAATGTAAATTATATGGTGAGAATT[G/A]
TATTTTAACCCTTATCTCACCTTTTGAGAAATAAAAGAAAGATTAAAAGAGAGATGAGTGGATGGTATGTTGGCTGTGATTGGATGACACATGGGTCCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of Unkown(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.50% 0.00% 0.15% 0.38% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 98.30% 0.00% 0.46% 1.19% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 98.30% 0.00% 0.26% 1.43% NA
Tropical Japonica  504 99.40% 0.00% 0.40% 0.20% NA
Japonica Intermediate  241 96.30% 0.00% 1.24% 2.49% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0806865309 C -> T LOC_Os08g11720.1 downstream_gene_variant ; 1125.0bp to feature; MODIFIER N Average:25.057; most accessible tissue: Minghui63 root, score: 57.225 N N N N
vg0806865309 C -> T LOC_Os08g11720.3 downstream_gene_variant ; 1126.0bp to feature; MODIFIER N Average:25.057; most accessible tissue: Minghui63 root, score: 57.225 N N N N
vg0806865309 C -> T LOC_Os08g11720.2 downstream_gene_variant ; 1126.0bp to feature; MODIFIER N Average:25.057; most accessible tissue: Minghui63 root, score: 57.225 N N N N
vg0806865309 C -> T LOC_Os08g11700-LOC_Os08g11720 intergenic_region ; MODIFIER N Average:25.057; most accessible tissue: Minghui63 root, score: 57.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0806865309 NA 1.94E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806865309 NA 4.24E-06 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806865309 2.95E-06 4.53E-08 mr1085 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806865309 NA 5.23E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806865309 NA 1.62E-08 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806865309 NA 3.95E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806865309 NA 2.79E-07 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251