\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806834963:

Variant ID: vg0806834963 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 6834963
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTCTTTCCAATTTTCCTCTAACCAAAGCACAGAATTGATCCCAAGCCCTATGTACAGTTGCACTGCGATTGATTAATCTCCGAGATCTACATAGTAG[C/T]
AATAGCAAAATTCGTAATTACTTTGCAATAGATGATAGTACCTGTCTATCAATGCAAAAATATCGTCAAAAAGTTTCTCTTCTTTATCCATTGAGTCATA

Reverse complement sequence

TATGACTCAATGGATAAAGAAGAGAAACTTTTTGACGATATTTTTGCATTGATAGACAGGTACTATCATCTATTGCAAAGTAATTACGAATTTTGCTATT[G/A]
CTACTATGTAGATCTCGGAGATTAATCAATCGCAGTGCAACTGTACATAGGGCTTGGGATCAATTCTGTGCTTTGGTTAGAGGAAAATTGGAAAGAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.80% 3.30% 0.08% 0.89% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 86.90% 10.10% 0.26% 2.71% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 76.90% 19.80% 0.13% 3.13% NA
Tropical Japonica  504 98.00% 0.00% 0.40% 1.59% NA
Japonica Intermediate  241 95.40% 0.40% 0.41% 3.73% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0806834963 C -> T LOC_Os08g11640.1 downstream_gene_variant ; 1660.0bp to feature; MODIFIER silent_mutation Average:11.462; most accessible tissue: Minghui63 root, score: 17.665 N N N N
vg0806834963 C -> T LOC_Os08g11650.1 downstream_gene_variant ; 829.0bp to feature; MODIFIER silent_mutation Average:11.462; most accessible tissue: Minghui63 root, score: 17.665 N N N N
vg0806834963 C -> T LOC_Os08g11660.1 downstream_gene_variant ; 4567.0bp to feature; MODIFIER silent_mutation Average:11.462; most accessible tissue: Minghui63 root, score: 17.665 N N N N
vg0806834963 C -> T LOC_Os08g11640-LOC_Os08g11650 intergenic_region ; MODIFIER silent_mutation Average:11.462; most accessible tissue: Minghui63 root, score: 17.665 N N N N
vg0806834963 C -> DEL N N silent_mutation Average:11.462; most accessible tissue: Minghui63 root, score: 17.665 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0806834963 6.87E-06 NA mr1195 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806834963 2.84E-06 2.84E-06 mr1237 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806834963 6.35E-08 NA mr1732 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251