\
| Variant ID: vg0806834963 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 6834963 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTTTCTTTCCAATTTTCCTCTAACCAAAGCACAGAATTGATCCCAAGCCCTATGTACAGTTGCACTGCGATTGATTAATCTCCGAGATCTACATAGTAG[C/T]
AATAGCAAAATTCGTAATTACTTTGCAATAGATGATAGTACCTGTCTATCAATGCAAAAATATCGTCAAAAAGTTTCTCTTCTTTATCCATTGAGTCATA
TATGACTCAATGGATAAAGAAGAGAAACTTTTTGACGATATTTTTGCATTGATAGACAGGTACTATCATCTATTGCAAAGTAATTACGAATTTTGCTATT[G/A]
CTACTATGTAGATCTCGGAGATTAATCAATCGCAGTGCAACTGTACATAGGGCTTGGGATCAATTCTGTGCTTTGGTTAGAGGAAAATTGGAAAGAAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.80% | 3.30% | 0.08% | 0.89% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 86.90% | 10.10% | 0.26% | 2.71% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 76.90% | 19.80% | 0.13% | 3.13% | NA |
| Tropical Japonica | 504 | 98.00% | 0.00% | 0.40% | 1.59% | NA |
| Japonica Intermediate | 241 | 95.40% | 0.40% | 0.41% | 3.73% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0806834963 | C -> T | LOC_Os08g11640.1 | downstream_gene_variant ; 1660.0bp to feature; MODIFIER | silent_mutation | Average:11.462; most accessible tissue: Minghui63 root, score: 17.665 | N | N | N | N |
| vg0806834963 | C -> T | LOC_Os08g11650.1 | downstream_gene_variant ; 829.0bp to feature; MODIFIER | silent_mutation | Average:11.462; most accessible tissue: Minghui63 root, score: 17.665 | N | N | N | N |
| vg0806834963 | C -> T | LOC_Os08g11660.1 | downstream_gene_variant ; 4567.0bp to feature; MODIFIER | silent_mutation | Average:11.462; most accessible tissue: Minghui63 root, score: 17.665 | N | N | N | N |
| vg0806834963 | C -> T | LOC_Os08g11640-LOC_Os08g11650 | intergenic_region ; MODIFIER | silent_mutation | Average:11.462; most accessible tissue: Minghui63 root, score: 17.665 | N | N | N | N |
| vg0806834963 | C -> DEL | N | N | silent_mutation | Average:11.462; most accessible tissue: Minghui63 root, score: 17.665 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0806834963 | 6.87E-06 | NA | mr1195 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806834963 | 2.84E-06 | 2.84E-06 | mr1237 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806834963 | 6.35E-08 | NA | mr1732 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |