RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0806818905:

Variant ID: vg0806818905 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 6818905
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:

TACGGAAGGACGACAGTTACCATTGGAATTATGCAAGGAATTTGAAAGATTAAATTTGGGAATTGTCAGTAGAGGTTTCGTTGCAGCCTTAGAAGCGAAG[T/C]
CCACTCTAATTGATCAAGTTAGAGAAGCCCAAATTAATGATCCTGATATTCAAGAAATCAAGAAGAATATGAGAAGAGGAAAAGCTATCGGTTTCTTGGA

Reverse complement sequence

TCCAAGAAACCGATAGCTTTTCCTCTTCTCATATTCTTCTTGATTTCTTGAATATCAGGATCATTAATTTGGGCTTCTCTAACTTGATCAATTAGAGTGG[A/G]
CTTCGCTTCTAAGGCTGCAACGAAACCTCTACTGACAATTCCCAAATTTAATCTTTCAAATTCCTTGCATAATTCCAATGGTAACTGTCGTCCTTCCGTA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.10%	31.30%	7.22%	3.41%	NA
All Indica	2759	79.60%	8.90%	11.45%	0.00%	NA
All Japonica	1512	9.90%	78.40%	1.12%	10.58%	NA
Aus	269	98.10%	1.50%	0.37%	0.00%	NA
Indica I	595	81.80%	13.60%	4.54%	0.00%	NA
Indica II	465	83.70%	8.80%	7.53%	0.00%	NA
Indica III	913	75.50%	6.40%	18.18%	0.00%	NA
Indica Intermediate	786	80.40%	8.40%	11.20%	0.00%	NA
Temperate Japonica	767	14.00%	65.40%	1.04%	19.56%	NA
Tropical Japonica	504	3.80%	94.40%	1.39%	0.40%	NA
Japonica Intermediate	241	10.00%	85.90%	0.83%	3.32%	NA
VI/Aromatic	96	92.70%	4.20%	3.12%	0.00%	NA
Intermediate	90	50.00%	44.40%	4.44%	1.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0806818905	T -> C	LOC_Os08g11620.1	missense_variant ; p.Ser527Pro; MODERATE	nonsynonymous_codon ; S527P	Average:12.788; most accessible tissue: Zhenshan97 flag leaf, score: 17.677	benign	-0.275	TOLERATED	1.00
vg0806818905	T -> DEL	LOC_Os08g11620.1	N	frameshift_variant	Average:12.788; most accessible tissue: Zhenshan97 flag leaf, score: 17.677	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0806818905	NA	6.82E-06	mr1415	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806818905	NA	6.82E-06	mr1567	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806818905	NA	8.84E-08	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806818905	4.00E-09	3.36E-08	mr1588_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 4 of 4 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0806818905:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact