\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806743013:

Variant ID: vg0806743013 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 6743013
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAAGGCGAGTGGAACGGCGGCGGCTGGCCAGGGAGAACGAAATTTCCCAACTAATCTTCACCATTTTCCGTGCACATGCTTTTCAAACTAATCTTTATT[A/G]
TTTTCCGCGCGCACACTTTTTAAACCGCTAAATATTGCCTTTTTTATAAAAAAAATTATTGAAAAGTTGCTTGAAAAAATCACTTTGTTCCATTTTTTTT

Reverse complement sequence

AAAAAAAATGGAACAAAGTGATTTTTTCAAGCAACTTTTCAATAATTTTTTTTATAAAAAAGGCAATATTTAGCGGTTTAAAAAGTGTGCGCGCGGAAAA[T/C]
AATAAAGATTAGTTTGAAAAGCATGTGCACGGAAAATGGTGAAGATTAGTTGGGAAATTTCGTTCTCCCTGGCCAGCCGCCGCCGTTCCACTCGCCTTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.20% 27.80% 0.02% 5.99% NA
All Indica  2759 88.40% 1.90% 0.00% 9.75% NA
All Japonica  1512 19.10% 80.60% 0.07% 0.20% NA
Aus  269 97.40% 0.70% 0.00% 1.86% NA
Indica I  595 99.70% 0.20% 0.00% 0.17% NA
Indica II  465 90.80% 4.10% 0.00% 5.16% NA
Indica III  913 80.10% 0.50% 0.00% 19.39% NA
Indica Intermediate  786 88.00% 3.40% 0.00% 8.52% NA
Temperate Japonica  767 31.20% 68.70% 0.13% 0.00% NA
Tropical Japonica  504 3.40% 96.00% 0.00% 0.60% NA
Japonica Intermediate  241 13.70% 86.30% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 3.10% 0.00% 1.04% NA
Intermediate  90 53.30% 41.10% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0806743013 A -> G LOC_Os08g11490.1 upstream_gene_variant ; 135.0bp to feature; MODIFIER silent_mutation Average:85.336; most accessible tissue: Callus, score: 93.047 N N N N
vg0806743013 A -> G LOC_Os08g11480.1 downstream_gene_variant ; 3327.0bp to feature; MODIFIER silent_mutation Average:85.336; most accessible tissue: Callus, score: 93.047 N N N N
vg0806743013 A -> G LOC_Os08g11500.1 downstream_gene_variant ; 2831.0bp to feature; MODIFIER silent_mutation Average:85.336; most accessible tissue: Callus, score: 93.047 N N N N
vg0806743013 A -> G LOC_Os08g11490-LOC_Os08g11500 intergenic_region ; MODIFIER silent_mutation Average:85.336; most accessible tissue: Callus, score: 93.047 N N N N
vg0806743013 A -> DEL N N silent_mutation Average:85.336; most accessible tissue: Callus, score: 93.047 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0806743013 A G -0.21 -0.29 -0.25 -0.11 -0.18 -0.17

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0806743013 NA 7.59E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806743013 NA 1.18E-09 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806743013 1.93E-07 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806743013 NA 1.57E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806743013 1.64E-06 NA mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806743013 NA 3.39E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806743013 NA 7.90E-06 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806743013 6.80E-09 NA mr1203_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806743013 NA 6.45E-07 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806743013 NA 7.45E-06 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806743013 NA 5.05E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806743013 NA 1.89E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806743013 NA 2.88E-19 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251