Search for Variation information by Variation ID:
Detailed information for vg0806703463:
| Variant ID: vg0806703463 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 6703463 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CACCCTGGAAGCACTAAGATGTACCAAGACCTAAAGCAACAATTCTGGTGGGCCAGTATGCGACGTGAGATAGCAGAATATGTGGCTCTATGTGATGTAT[A/G]
TCAGCGGGTCAAGGCAAAACATCAGAAGCCAGCCGGTCTGTTACAACCGTTGAAGATTCCAGAGTGGAAGTGGGAAGAAATAGGAATGGATTTTATAACC
Reverse complement sequence
GGTTATAAAATCCATTCCTATTTCTTCCCACTTCCACTCTGGAATCTTCAACGGTTGTAACAGACCGGCTGGCTTCTGATGTTTTGCCTTGACCCGCTGA[T/C]
ATACATCACATAGAGCCACATATTCTGCTATCTCACGTCGCATACTGGCCCACCAGAATTGTTGCTTTAGGTCTTGGTACATCTTAGTGCTTCCAGGGTG
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.20% | 0.10% | 33.58% | 11.11% | NA |
| All Indica | 2759 | 31.70% | 0.10% | 51.14% | 17.07% | NA |
| All Japonica | 1512 | 96.20% | 0.00% | 2.91% | 0.86% | NA |
| Aus | 269 | 53.90% | 0.40% | 36.06% | 9.67% | NA |
| Indica I | 595 | 16.00% | 0.50% | 45.21% | 38.32% | NA |
| Indica II | 465 | 44.90% | 0.00% | 39.78% | 15.27% | NA |
| Indica III | 913 | 33.10% | 0.00% | 63.86% | 3.07% | NA |
| Indica Intermediate | 786 | 34.10% | 0.00% | 47.58% | 18.32% | NA |
| Temperate Japonica | 767 | 95.60% | 0.00% | 3.65% | 0.78% | NA |
| Tropical Japonica | 504 | 97.80% | 0.00% | 1.19% | 0.99% | NA |
| Japonica Intermediate | 241 | 95.00% | 0.00% | 4.15% | 0.83% | NA |
| VI/Aromatic | 96 | 83.30% | 0.00% | 14.58% | 2.08% | NA |
| Intermediate | 90 | 62.20% | 0.00% | 23.33% | 14.44% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0806703463 | A -> G | LOC_Os08g11430.1 | missense_variant ; p.Tyr1096Cys; MODERATE | nonsynonymous_codon ; Y1096C | Average:13.869; most accessible tissue: Minghui63 flag leaf, score: 18.808 | possibly damaging  |
-1.978 |
TOLERATED | 1.00 |
| vg0806703463 | A -> DEL | LOC_Os08g11430.1 | N | frameshift_variant | Average:13.869; most accessible tissue: Minghui63 flag leaf, score: 18.808 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0806703463 | NA | 3.56E-09 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806703463 | 3.92E-06 | 4.78E-06 | mr1657 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806703463 | NA | 1.36E-06 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806703463 | NA | 6.32E-11 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806703463 | NA | 2.99E-36 | mr1828 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806703463 | NA | 1.67E-08 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806703463 | NA | 1.07E-11 | mr1938 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |