RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0806625593:

Variant ID: vg0806625593 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 6625593
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCCCCTGCCGTACCTCGGCCAACAGGGCAATCTGCGGATCCCAAATCCTCACGTTTTTCCGATGGGCGTAAATGATCACAGTAGGTTTAGTAATCAAACA[A/G]
ACCGGTCCCATGATACGGCGTGTGGTAAGTACGTAGGGTGCTTGAATAGACGTCAAAATGTTCGGTCCTTAACGACCTAGACGGAGCTACTGCATCAGGG

Reverse complement sequence

CCCTGATGCAGTAGCTCCGTCTAGGTCGTTAAGGACCGAACATTTTGACGTCTATTCAAGCACCCTACGTACTTACCACACGCCGTATCATGGGACCGGT[T/C]
TGTTTGATTACTAAACCTACTGTGATCATTTACGCCCATCGGAAAAACGTGAGGATTTGGGATCCGCAGATTGCCCTGTTGGCCGAGGTACGGCAGGGGG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.90%	1.00%	0.61%	1.52%	NA
All Indica	2759	98.60%	0.90%	0.47%	0.04%	NA
All Japonica	1512	92.90%	1.30%	1.06%	4.70%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	94.20%	3.40%	2.37%	0.00%	NA
Indica III	913	99.80%	0.10%	0.00%	0.11%	NA
Indica Intermediate	786	99.00%	0.80%	0.25%	0.00%	NA
Temperate Japonica	767	88.50%	2.20%	1.30%	7.95%	NA
Tropical Japonica	504	98.00%	0.20%	0.79%	0.99%	NA
Japonica Intermediate	241	96.30%	0.80%	0.83%	2.07%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0806625593	A -> G	LOC_Os08g11260.1	downstream_gene_variant ; 2658.0bp to feature; MODIFIER	silent_mutation	Average:17.493; most accessible tissue: Minghui63 young leaf, score: 38.036	N	N	N	N
vg0806625593	A -> G	LOC_Os08g11265.1	downstream_gene_variant ; 1322.0bp to feature; MODIFIER	silent_mutation	Average:17.493; most accessible tissue: Minghui63 young leaf, score: 38.036	N	N	N	N
vg0806625593	A -> G	LOC_Os08g11270.1	downstream_gene_variant ; 2858.0bp to feature; MODIFIER	silent_mutation	Average:17.493; most accessible tissue: Minghui63 young leaf, score: 38.036	N	N	N	N
vg0806625593	A -> G	LOC_Os08g11260-LOC_Os08g11265	intergenic_region ; MODIFIER	silent_mutation	Average:17.493; most accessible tissue: Minghui63 young leaf, score: 38.036	N	N	N	N
vg0806625593	A -> DEL	N	N	silent_mutation	Average:17.493; most accessible tissue: Minghui63 young leaf, score: 38.036	N	N	N	N

Showing 1 to 5 of 5 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0806625593	NA	2.84E-09	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806625593	2.61E-06	2.61E-06	mr1525	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0806625593:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact