Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806624976:

Variant ID: vg0806624976 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 6624976
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

CGGGTTAAGTACAAGATTGTACTCGCGAGTCTTACCCATAAAAATATATGTAAGGGGAGAGAGAAGTATGCATGTTTACCTTAACCTAGAGCAACCTAAG[T/C]
TCAACATTTGCATAAAGCCAATTTTATTGAGCAGATATAAGTGAAAGCGATAACACAATAAACTGATTAGCAACAATATAAAATTCTGGACAGCAAGCAA

Reverse complement sequence

TTGCTTGCTGTCCAGAATTTTATATTGTTGCTAATCAGTTTATTGTGTTATCGCTTTCACTTATATCTGCTCAATAAAATTGGCTTTATGCAAATGTTGA[A/G]
CTTAGGTTGCTCTAGGTTAAGGTAAACATGCATACTTCTCTCTCCCCTTACATATATTTTTATGGGTAAGACTCGCGAGTACAATCTTGTACTTAACCCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.50%	2.60%	5.80%	0.08%	NA
All Indica	2759	86.10%	4.40%	9.39%	0.14%	NA
All Japonica	1512	99.30%	0.00%	0.73%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	82.00%	1.20%	16.30%	0.50%	NA
Indica II	465	94.40%	1.10%	4.52%	0.00%	NA
Indica III	913	82.40%	9.50%	8.11%	0.00%	NA
Indica Intermediate	786	88.50%	2.80%	8.52%	0.13%	NA
Temperate Japonica	767	98.60%	0.00%	1.43%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	1.10%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0806624976	T -> C	LOC_Os08g11260.1	downstream_gene_variant ; 2041.0bp to feature; MODIFIER	silent_mutation	Average:27.647; most accessible tissue: Minghui63 young leaf, score: 58.21	N	N	N	N
vg0806624976	T -> C	LOC_Os08g11265.1	downstream_gene_variant ; 1939.0bp to feature; MODIFIER	silent_mutation	Average:27.647; most accessible tissue: Minghui63 young leaf, score: 58.21	N	N	N	N
vg0806624976	T -> C	LOC_Os08g11270.1	downstream_gene_variant ; 3475.0bp to feature; MODIFIER	silent_mutation	Average:27.647; most accessible tissue: Minghui63 young leaf, score: 58.21	N	N	N	N
vg0806624976	T -> C	LOC_Os08g11260-LOC_Os08g11265	intergenic_region ; MODIFIER	silent_mutation	Average:27.647; most accessible tissue: Minghui63 young leaf, score: 58.21	N	N	N	N
vg0806624976	T -> DEL	N	N	silent_mutation	Average:27.647; most accessible tissue: Minghui63 young leaf, score: 58.21	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0806624976	1.41E-06	7.87E-06	mr1012	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251