\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806624976:

Variant ID: vg0806624976 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 6624976
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


CGGGTTAAGTACAAGATTGTACTCGCGAGTCTTACCCATAAAAATATATGTAAGGGGAGAGAGAAGTATGCATGTTTACCTTAACCTAGAGCAACCTAAG[T/C]
TCAACATTTGCATAAAGCCAATTTTATTGAGCAGATATAAGTGAAAGCGATAACACAATAAACTGATTAGCAACAATATAAAATTCTGGACAGCAAGCAA

Reverse complement sequence

TTGCTTGCTGTCCAGAATTTTATATTGTTGCTAATCAGTTTATTGTGTTATCGCTTTCACTTATATCTGCTCAATAAAATTGGCTTTATGCAAATGTTGA[A/G]
CTTAGGTTGCTCTAGGTTAAGGTAAACATGCATACTTCTCTCTCCCCTTACATATATTTTTATGGGTAAGACTCGCGAGTACAATCTTGTACTTAACCCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 2.60% 5.80% 0.08% NA
All Indica  2759 86.10% 4.40% 9.39% 0.14% NA
All Japonica  1512 99.30% 0.00% 0.73% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 82.00% 1.20% 16.30% 0.50% NA
Indica II  465 94.40% 1.10% 4.52% 0.00% NA
Indica III  913 82.40% 9.50% 8.11% 0.00% NA
Indica Intermediate  786 88.50% 2.80% 8.52% 0.13% NA
Temperate Japonica  767 98.60% 0.00% 1.43% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 95.60% 1.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0806624976 T -> C LOC_Os08g11260.1 downstream_gene_variant ; 2041.0bp to feature; MODIFIER silent_mutation Average:27.647; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N
vg0806624976 T -> C LOC_Os08g11265.1 downstream_gene_variant ; 1939.0bp to feature; MODIFIER silent_mutation Average:27.647; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N
vg0806624976 T -> C LOC_Os08g11270.1 downstream_gene_variant ; 3475.0bp to feature; MODIFIER silent_mutation Average:27.647; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N
vg0806624976 T -> C LOC_Os08g11260-LOC_Os08g11265 intergenic_region ; MODIFIER silent_mutation Average:27.647; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N
vg0806624976 T -> DEL N N silent_mutation Average:27.647; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0806624976 1.41E-06 7.87E-06 mr1012 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251