\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806609517:

Variant ID: vg0806609517 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 6609517
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTTTTCAAATTGATCTAGTAATTTCGTAGATACATCCGGCATGTATCTACAAAGGTACACAATGTTTTATACACAATTTATCGTACCTATTCAGATCA[C/T]
ACAGCATTGCTAGATCAATAATTTATTATGTTTACCTAGAGCATGTTTTTTATACAATATCTATTGTGCGAGTGCTTCCGACGATAGGCCAACTACAGTC

Reverse complement sequence

GACTGTAGTTGGCCTATCGTCGGAAGCACTCGCACAATAGATATTGTATAAAAAACATGCTCTAGGTAAACATAATAAATTATTGATCTAGCAATGCTGT[G/A]
TGATCTGAATAGGTACGATAAATTGTGTATAAAACATTGTGTACCTTTGTAGATACATGCCGGATGTATCTACGAAATTACTAGATCAATTTGAAAAACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.80% 8.90% 3.55% 59.69% NA
All Indica  2759 3.70% 7.40% 1.59% 87.31% NA
All Japonica  1512 77.20% 14.10% 6.02% 2.65% NA
Aus  269 2.20% 0.70% 1.12% 95.91% NA
Indica I  595 5.20% 1.70% 1.85% 91.26% NA
Indica II  465 4.90% 0.60% 1.51% 92.90% NA
Indica III  913 2.10% 12.80% 0.88% 84.23% NA
Indica Intermediate  786 3.70% 9.40% 2.29% 84.61% NA
Temperate Japonica  767 60.60% 26.30% 10.56% 2.48% NA
Tropical Japonica  504 96.20% 0.80% 0.00% 2.98% NA
Japonica Intermediate  241 90.50% 2.90% 4.15% 2.49% NA
VI/Aromatic  96 3.10% 1.00% 29.17% 66.67% NA
Intermediate  90 40.00% 2.20% 2.22% 55.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0806609517 C -> T LOC_Os08g11250.1 upstream_gene_variant ; 4707.0bp to feature; MODIFIER silent_mutation Average:8.598; most accessible tissue: Minghui63 flag leaf, score: 14.393 N N N N
vg0806609517 C -> T LOC_Os08g11240.1 downstream_gene_variant ; 696.0bp to feature; MODIFIER silent_mutation Average:8.598; most accessible tissue: Minghui63 flag leaf, score: 14.393 N N N N
vg0806609517 C -> T LOC_Os08g11240-LOC_Os08g11250 intergenic_region ; MODIFIER silent_mutation Average:8.598; most accessible tissue: Minghui63 flag leaf, score: 14.393 N N N N
vg0806609517 C -> DEL N N silent_mutation Average:8.598; most accessible tissue: Minghui63 flag leaf, score: 14.393 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0806609517 NA 2.61E-19 mr1035 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517 NA 6.78E-07 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517 NA 1.40E-16 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517 NA 1.82E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517 NA 9.59E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517 NA 1.93E-14 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517 NA 2.61E-10 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517 NA 1.31E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517 NA 1.92E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517 NA 1.84E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517 9.46E-06 NA mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517 NA 1.95E-14 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517 NA 7.95E-21 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517 NA 7.59E-08 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517 NA 6.13E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517 NA 2.27E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517 NA 3.85E-06 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517 7.17E-06 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517 NA 3.05E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517 NA 1.10E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517 NA 9.14E-06 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517 NA 1.51E-12 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517 NA 3.10E-08 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517 NA 2.97E-19 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251