Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806609517:

Variant ID: vg0806609517 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 6609517
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

GGTTTTTCAAATTGATCTAGTAATTTCGTAGATACATCCGGCATGTATCTACAAAGGTACACAATGTTTTATACACAATTTATCGTACCTATTCAGATCA[C/T]
ACAGCATTGCTAGATCAATAATTTATTATGTTTACCTAGAGCATGTTTTTTATACAATATCTATTGTGCGAGTGCTTCCGACGATAGGCCAACTACAGTC

Reverse complement sequence

GACTGTAGTTGGCCTATCGTCGGAAGCACTCGCACAATAGATATTGTATAAAAAACATGCTCTAGGTAAACATAATAAATTATTGATCTAGCAATGCTGT[G/A]
TGATCTGAATAGGTACGATAAATTGTGTATAAAACATTGTGTACCTTTGTAGATACATGCCGGATGTATCTACGAAATTACTAGATCAATTTGAAAAACC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.80%	8.90%	3.55%	59.69%	NA
All Indica	2759	3.70%	7.40%	1.59%	87.31%	NA
All Japonica	1512	77.20%	14.10%	6.02%	2.65%	NA
Aus	269	2.20%	0.70%	1.12%	95.91%	NA
Indica I	595	5.20%	1.70%	1.85%	91.26%	NA
Indica II	465	4.90%	0.60%	1.51%	92.90%	NA
Indica III	913	2.10%	12.80%	0.88%	84.23%	NA
Indica Intermediate	786	3.70%	9.40%	2.29%	84.61%	NA
Temperate Japonica	767	60.60%	26.30%	10.56%	2.48%	NA
Tropical Japonica	504	96.20%	0.80%	0.00%	2.98%	NA
Japonica Intermediate	241	90.50%	2.90%	4.15%	2.49%	NA
VI/Aromatic	96	3.10%	1.00%	29.17%	66.67%	NA
Intermediate	90	40.00%	2.20%	2.22%	55.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0806609517	C -> T	LOC_Os08g11250.1	upstream_gene_variant ; 4707.0bp to feature; MODIFIER	silent_mutation	Average:8.598; most accessible tissue: Minghui63 flag leaf, score: 14.393	N	N	N	N
vg0806609517	C -> T	LOC_Os08g11240.1	downstream_gene_variant ; 696.0bp to feature; MODIFIER	silent_mutation	Average:8.598; most accessible tissue: Minghui63 flag leaf, score: 14.393	N	N	N	N
vg0806609517	C -> T	LOC_Os08g11240-LOC_Os08g11250	intergenic_region ; MODIFIER	silent_mutation	Average:8.598; most accessible tissue: Minghui63 flag leaf, score: 14.393	N	N	N	N
vg0806609517	C -> DEL	N	N	silent_mutation	Average:8.598; most accessible tissue: Minghui63 flag leaf, score: 14.393	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0806609517	NA	2.61E-19	mr1035	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517	NA	6.78E-07	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517	NA	1.40E-16	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517	NA	1.82E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517	NA	9.59E-07	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517	NA	1.93E-14	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517	NA	2.61E-10	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517	NA	1.31E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517	NA	1.92E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517	NA	1.84E-10	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517	9.46E-06	NA	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517	NA	1.95E-14	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517	NA	7.95E-21	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517	NA	7.59E-08	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517	NA	6.13E-06	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517	NA	2.27E-06	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517	NA	3.85E-06	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517	7.17E-06	NA	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517	NA	3.05E-06	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517	NA	1.10E-06	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517	NA	9.14E-06	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517	NA	1.51E-12	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517	NA	3.10E-08	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806609517	NA	2.97E-19	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251