\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806593377:

Variant ID: vg0806593377 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 6593377
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 35. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTGCGAGACCCAAGTATGAGTCCGCTGAGAAGTTCCTCCTCCCCCTCCTGCTAGGCATGGTCCTCCTTTTATATTCTAAGGGGATACCACATATGCTG[T/C]
GAGTGCTCCCTCGGGAGAAGGGAAAGTATTCTCTATATTAATTACATGTCTTGTGCCTTAGCCCAGAAGCTATCTACACATCGGCTGCTGCGTGGGGTCC

Reverse complement sequence

GGACCCCACGCAGCAGCCGATGTGTAGATAGCTTCTGGGCTAAGGCACAAGACATGTAATTAATATAGAGAATACTTTCCCTTCTCCCGAGGGAGCACTC[A/G]
CAGCATATGTGGTATCCCCTTAGAATATAAAAGGAGGACCATGCCTAGCAGGAGGGGGAGGAGGAACTTCTCAGCGGACTCATACTTGGGTCTCGCAACC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.60% 0.60% 46.47% 25.31% NA
All Indica  2759 3.20% 0.90% 59.59% 36.32% NA
All Japonica  1512 77.60% 0.10% 15.34% 6.94% NA
Aus  269 0.40% 1.10% 88.10% 10.41% NA
Indica I  595 4.20% 0.20% 49.08% 46.55% NA
Indica II  465 4.70% 0.90% 54.62% 39.78% NA
Indica III  913 1.30% 1.50% 65.72% 31.43% NA
Indica Intermediate  786 3.80% 0.60% 63.36% 32.19% NA
Temperate Japonica  767 61.50% 0.10% 27.12% 11.21% NA
Tropical Japonica  504 96.20% 0.00% 2.98% 0.79% NA
Japonica Intermediate  241 90.00% 0.00% 3.73% 6.22% NA
VI/Aromatic  96 3.10% 0.00% 44.79% 52.08% NA
Intermediate  90 43.30% 0.00% 44.44% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0806593377 T -> C LOC_Os08g11220.1 upstream_gene_variant ; 4830.0bp to feature; MODIFIER silent_mutation Average:4.93; most accessible tissue: Callus, score: 9.561 N N N N
vg0806593377 T -> C LOC_Os08g11220.2 upstream_gene_variant ; 4830.0bp to feature; MODIFIER silent_mutation Average:4.93; most accessible tissue: Callus, score: 9.561 N N N N
vg0806593377 T -> C LOC_Os08g11220.3 upstream_gene_variant ; 4830.0bp to feature; MODIFIER silent_mutation Average:4.93; most accessible tissue: Callus, score: 9.561 N N N N
vg0806593377 T -> C LOC_Os08g11220.6 upstream_gene_variant ; 4830.0bp to feature; MODIFIER silent_mutation Average:4.93; most accessible tissue: Callus, score: 9.561 N N N N
vg0806593377 T -> C LOC_Os08g11220.8 upstream_gene_variant ; 4830.0bp to feature; MODIFIER silent_mutation Average:4.93; most accessible tissue: Callus, score: 9.561 N N N N
vg0806593377 T -> C LOC_Os08g11220.5 upstream_gene_variant ; 4889.0bp to feature; MODIFIER silent_mutation Average:4.93; most accessible tissue: Callus, score: 9.561 N N N N
vg0806593377 T -> C LOC_Os08g11220.4 upstream_gene_variant ; 4892.0bp to feature; MODIFIER silent_mutation Average:4.93; most accessible tissue: Callus, score: 9.561 N N N N
vg0806593377 T -> C LOC_Os08g11210-LOC_Os08g11220 intergenic_region ; MODIFIER silent_mutation Average:4.93; most accessible tissue: Callus, score: 9.561 N N N N
vg0806593377 T -> DEL N N silent_mutation Average:4.93; most accessible tissue: Callus, score: 9.561 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0806593377 NA 2.66E-06 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377 1.16E-06 NA mr1100 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377 NA 4.58E-08 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377 NA 3.96E-06 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377 2.47E-06 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377 NA 3.53E-06 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377 NA 4.69E-26 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377 7.10E-07 NA mr1395 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377 NA 7.54E-07 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377 7.37E-06 NA mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377 3.75E-06 NA mr1613 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377 NA 1.32E-08 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377 NA 6.91E-14 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377 NA 1.61E-07 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377 NA 1.21E-07 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377 NA 8.41E-08 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377 2.37E-06 NA mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377 NA 6.70E-07 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377 3.08E-06 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377 NA 2.09E-19 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377 NA 9.89E-06 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377 NA 1.78E-20 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251