Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806593377:

Variant ID: vg0806593377 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 6593377
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 35. )

Flanking Sequence (100 bp) in Reference Genome:

GGTTGCGAGACCCAAGTATGAGTCCGCTGAGAAGTTCCTCCTCCCCCTCCTGCTAGGCATGGTCCTCCTTTTATATTCTAAGGGGATACCACATATGCTG[T/C]
GAGTGCTCCCTCGGGAGAAGGGAAAGTATTCTCTATATTAATTACATGTCTTGTGCCTTAGCCCAGAAGCTATCTACACATCGGCTGCTGCGTGGGGTCC

Reverse complement sequence

GGACCCCACGCAGCAGCCGATGTGTAGATAGCTTCTGGGCTAAGGCACAAGACATGTAATTAATATAGAGAATACTTTCCCTTCTCCCGAGGGAGCACTC[A/G]
CAGCATATGTGGTATCCCCTTAGAATATAAAAGGAGGACCATGCCTAGCAGGAGGGGGAGGAGGAACTTCTCAGCGGACTCATACTTGGGTCTCGCAACC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.60%	0.60%	46.47%	25.31%	NA
All Indica	2759	3.20%	0.90%	59.59%	36.32%	NA
All Japonica	1512	77.60%	0.10%	15.34%	6.94%	NA
Aus	269	0.40%	1.10%	88.10%	10.41%	NA
Indica I	595	4.20%	0.20%	49.08%	46.55%	NA
Indica II	465	4.70%	0.90%	54.62%	39.78%	NA
Indica III	913	1.30%	1.50%	65.72%	31.43%	NA
Indica Intermediate	786	3.80%	0.60%	63.36%	32.19%	NA
Temperate Japonica	767	61.50%	0.10%	27.12%	11.21%	NA
Tropical Japonica	504	96.20%	0.00%	2.98%	0.79%	NA
Japonica Intermediate	241	90.00%	0.00%	3.73%	6.22%	NA
VI/Aromatic	96	3.10%	0.00%	44.79%	52.08%	NA
Intermediate	90	43.30%	0.00%	44.44%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0806593377	T -> C	LOC_Os08g11220.1	upstream_gene_variant ; 4830.0bp to feature; MODIFIER	silent_mutation	Average:4.93; most accessible tissue: Callus, score: 9.561	N	N	N	N
vg0806593377	T -> C	LOC_Os08g11220.2	upstream_gene_variant ; 4830.0bp to feature; MODIFIER	silent_mutation	Average:4.93; most accessible tissue: Callus, score: 9.561	N	N	N	N
vg0806593377	T -> C	LOC_Os08g11220.3	upstream_gene_variant ; 4830.0bp to feature; MODIFIER	silent_mutation	Average:4.93; most accessible tissue: Callus, score: 9.561	N	N	N	N
vg0806593377	T -> C	LOC_Os08g11220.6	upstream_gene_variant ; 4830.0bp to feature; MODIFIER	silent_mutation	Average:4.93; most accessible tissue: Callus, score: 9.561	N	N	N	N
vg0806593377	T -> C	LOC_Os08g11220.8	upstream_gene_variant ; 4830.0bp to feature; MODIFIER	silent_mutation	Average:4.93; most accessible tissue: Callus, score: 9.561	N	N	N	N
vg0806593377	T -> C	LOC_Os08g11220.5	upstream_gene_variant ; 4889.0bp to feature; MODIFIER	silent_mutation	Average:4.93; most accessible tissue: Callus, score: 9.561	N	N	N	N
vg0806593377	T -> C	LOC_Os08g11220.4	upstream_gene_variant ; 4892.0bp to feature; MODIFIER	silent_mutation	Average:4.93; most accessible tissue: Callus, score: 9.561	N	N	N	N
vg0806593377	T -> C	LOC_Os08g11210-LOC_Os08g11220	intergenic_region ; MODIFIER	silent_mutation	Average:4.93; most accessible tissue: Callus, score: 9.561	N	N	N	N
vg0806593377	T -> DEL	N	N	silent_mutation	Average:4.93; most accessible tissue: Callus, score: 9.561	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0806593377	NA	2.66E-06	mr1080	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377	1.16E-06	NA	mr1100	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377	NA	4.58E-08	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377	NA	3.96E-06	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377	2.47E-06	NA	mr1203	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377	NA	3.53E-06	mr1203	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377	NA	4.69E-26	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377	7.10E-07	NA	mr1395	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377	NA	7.54E-07	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377	7.37E-06	NA	mr1594	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377	3.75E-06	NA	mr1613	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377	NA	1.32E-08	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377	NA	6.91E-14	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377	NA	1.61E-07	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377	NA	1.21E-07	mr1962	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377	NA	8.41E-08	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377	2.37E-06	NA	mr1100_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377	NA	6.70E-07	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377	3.08E-06	NA	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377	NA	2.09E-19	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377	NA	9.89E-06	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806593377	NA	1.78E-20	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251