| Variant ID: vg0806551012 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 6551012 |
| Reference Allele: A | Alternative Allele: C,T |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 236. )
GCCATTTACCCTTCGCCGCCCCCTCTAGCCTTTTCTTGAGCGCCTCAAGGATCTTACCATTCGTACGTTCGGCCGCCCCATTTGACTGTGGGTGCGCGAC[A/C,T]
GAAGCGAACATGATTTCCAGGTTTAGCCCTTCGCACATTTCTCTGAACTTATCAATTGCTTGCCGTTGTCAGTGATGAATTCTTTTGGCACTCCAAAATG
CATTTTGGAGTGCCAAAAGAATTCATCACTGACAACGGCAAGCAATTGATAAGTTCAGAGAAATGTGCGAAGGGCTAAACCTGGAAATCATGTTCGCTTC[T/G,A]
GTCGCGCACCCACAGTCAAATGGGGCGGCCGAACGTACGAATGGTAAGATCCTTGAGGCGCTCAAGAAAAGGCTAGAGGGGGCGGCGAAGGGTAAATGGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.90% | 10.80% | 7.41% | 9.63% | T: 0.30% |
| All Indica | 2759 | 53.00% | 18.20% | 12.36% | 15.98% | T: 0.47% |
| All Japonica | 1512 | 99.30% | 0.10% | 0.20% | 0.40% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 54.60% | 11.60% | 16.81% | 16.97% | NA |
| Indica II | 465 | 61.90% | 12.90% | 5.59% | 19.35% | T: 0.22% |
| Indica III | 913 | 39.10% | 26.20% | 16.21% | 17.20% | T: 1.31% |
| Indica Intermediate | 786 | 62.70% | 16.90% | 8.52% | 11.83% | NA |
| Temperate Japonica | 767 | 99.00% | 0.00% | 0.39% | 0.65% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 8.90% | 5.56% | 8.89% | T: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0806551012 | A -> C | LOC_Os08g11130.1 | downstream_gene_variant ; 2516.0bp to feature; MODIFIER | silent_mutation | Average:42.809; most accessible tissue: Minghui63 young leaf, score: 76.82 | N | N | N | N |
| vg0806551012 | A -> C | LOC_Os08g11140.1 | downstream_gene_variant ; 1952.0bp to feature; MODIFIER | silent_mutation | Average:42.809; most accessible tissue: Minghui63 young leaf, score: 76.82 | N | N | N | N |
| vg0806551012 | A -> C | LOC_Os08g11150.1 | intron_variant ; MODIFIER | silent_mutation | Average:42.809; most accessible tissue: Minghui63 young leaf, score: 76.82 | N | N | N | N |
| vg0806551012 | A -> T | LOC_Os08g11130.1 | downstream_gene_variant ; 2516.0bp to feature; MODIFIER | silent_mutation | Average:42.809; most accessible tissue: Minghui63 young leaf, score: 76.82 | N | N | N | N |
| vg0806551012 | A -> T | LOC_Os08g11140.1 | downstream_gene_variant ; 1952.0bp to feature; MODIFIER | silent_mutation | Average:42.809; most accessible tissue: Minghui63 young leaf, score: 76.82 | N | N | N | N |
| vg0806551012 | A -> T | LOC_Os08g11150.1 | intron_variant ; MODIFIER | silent_mutation | Average:42.809; most accessible tissue: Minghui63 young leaf, score: 76.82 | N | N | N | N |
| vg0806551012 | A -> DEL | N | N | silent_mutation | Average:42.809; most accessible tissue: Minghui63 young leaf, score: 76.82 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0806551012 | NA | 5.55E-06 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806551012 | NA | 7.21E-06 | mr1150 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806551012 | NA | 4.86E-06 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806551012 | 2.28E-07 | 2.28E-07 | mr1926 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806551012 | 8.45E-06 | 4.43E-07 | mr1208_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806551012 | 1.38E-06 | 6.08E-07 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806551012 | NA | 3.97E-06 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806551012 | 4.78E-06 | 3.86E-07 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806551012 | 5.69E-06 | 1.06E-06 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806551012 | 5.35E-06 | 5.35E-06 | mr1945_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |