\
| Variant ID: vg0806548377 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 6548377 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCAATTCTTTTTGATCTAGATTCTCGCGGCCCACTGCTCGACCGAGCGAACCATGTGGGCTCATATTGACGGCTTCAAGAACCATCTTCGAGCCAAGGAC[A/G]
ATGAACTGGGTCGCAAGAGCTTGGAGATGGAGGGCCTCGCCAACACCCTCAAAGAGGCGAAGGCTGAGAACAAGTGGCTCCAAGCTGAGCTGGAGAAGGG
CCCTTCTCCAGCTCAGCTTGGAGCCACTTGTTCTCAGCCTTCGCCTCTTTGAGGGTGTTGGCGAGGCCCTCCATCTCCAAGCTCTTGCGACCCAGTTCAT[T/C]
GTCCTTGGCTCGAAGATGGTTCTTGAAGCCGTCAATATGAGCCCACATGGTTCGCTCGGTCGAGCAGTGGGCCGCGAGAATCTAGATCAAAAAGAATTGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.70% | 13.30% | 7.22% | 46.72% | NA |
| All Indica | 2759 | 14.00% | 9.80% | 6.20% | 70.03% | NA |
| All Japonica | 1512 | 73.70% | 23.30% | 0.53% | 2.38% | NA |
| Aus | 269 | 1.90% | 0.70% | 48.33% | 49.07% | NA |
| Indica I | 595 | 30.80% | 6.10% | 2.86% | 60.34% | NA |
| Indica II | 465 | 9.50% | 2.80% | 4.52% | 83.23% | NA |
| Indica III | 913 | 5.00% | 13.60% | 7.45% | 73.93% | NA |
| Indica Intermediate | 786 | 14.20% | 12.50% | 8.27% | 65.01% | NA |
| Temperate Japonica | 767 | 55.00% | 42.20% | 0.78% | 1.96% | NA |
| Tropical Japonica | 504 | 96.20% | 0.80% | 0.40% | 2.58% | NA |
| Japonica Intermediate | 241 | 86.30% | 10.40% | 0.00% | 3.32% | NA |
| VI/Aromatic | 96 | 3.10% | 1.00% | 27.08% | 68.75% | NA |
| Intermediate | 90 | 43.30% | 3.30% | 6.67% | 46.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0806548377 | A -> G | LOC_Os08g11130.1 | missense_variant ; p.Asn532Asp; MODERATE | nonsynonymous_codon | Average:10.551; most accessible tissue: Callus, score: 28.358 | possibly damaging |
-1.653 |
TOLERATED | 1.00 |
| vg0806548377 | A -> DEL | LOC_Os08g11130.1 | N | frameshift_variant | Average:10.551; most accessible tissue: Callus, score: 28.358 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0806548377 | NA | 4.40E-17 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806548377 | NA | 8.61E-07 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806548377 | NA | 1.53E-13 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806548377 | NA | 3.21E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806548377 | 3.33E-06 | 8.17E-07 | mr1415 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806548377 | NA | 1.31E-08 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806548377 | 3.33E-06 | 8.17E-07 | mr1567 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806548377 | NA | 4.99E-13 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806548377 | NA | 4.94E-10 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806548377 | NA | 5.50E-10 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806548377 | NA | 2.11E-17 | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806548377 | NA | 7.35E-07 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806548377 | NA | 6.52E-06 | mr1080_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |