\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806547817:

Variant ID: vg0806547817 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 6547817
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGATCGCAGCGGCCAAGGTGTCCAAGAAGAAAGTGCTCGTCGATGTCGCTCGTGTTTTCAGCGACGACAAGTCTTCGGACGAGACCCCTACTTCGCCTG[C/T]
TGGTCGGAGCATGGGTCTCTCGACCGCTCCCGGTGCTGTGGTCGAGGTGGGCAGAGTGGGTGGGAGCGTTGCTGCCGGGACTTTAGCTTCTGCTGACCGG

Reverse complement sequence

CCGGTCAGCAGAAGCTAAAGTCCCGGCAGCAACGCTCCCACCCACTCTGCCCACCTCGACCACAGCACCGGGAGCGGTCGAGAGACCCATGCTCCGACCA[G/A]
CAGGCGAAGTAGGGGTCTCGTCCGAAGACTTGTCGTCGCTGAAAACACGAGCGACATCGACGAGCACTTTCTTCTTGGACACCTTGGCCGCTGCGATCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.30% 3.20% 4.95% 40.54% NA
All Indica  2759 31.60% 0.10% 7.54% 60.78% NA
All Japonica  1512 87.60% 9.50% 0.86% 1.98% NA
Aus  269 55.00% 0.00% 2.60% 42.38% NA
Indica I  595 33.90% 0.00% 15.63% 50.42% NA
Indica II  465 16.60% 0.00% 7.10% 76.34% NA
Indica III  913 32.50% 0.20% 2.63% 64.62% NA
Indica Intermediate  786 37.70% 0.00% 7.38% 54.96% NA
Temperate Japonica  767 96.20% 0.50% 1.17% 2.09% NA
Tropical Japonica  504 86.70% 11.70% 0.20% 1.39% NA
Japonica Intermediate  241 62.20% 33.60% 1.24% 2.90% NA
VI/Aromatic  96 35.40% 1.00% 1.04% 62.50% NA
Intermediate  90 48.90% 6.70% 5.56% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0806547817 C -> T LOC_Os08g11130.1 missense_variant ; p.Ala376Val; MODERATE nonsynonymous_codon ; A376V Average:9.965; most accessible tissue: Callus, score: 25.451 possibly damaging 1.553 DELETERIOUS 0.05
vg0806547817 C -> DEL LOC_Os08g11130.1 N frameshift_variant Average:9.965; most accessible tissue: Callus, score: 25.451 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0806547817 NA 6.62E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806547817 NA 8.44E-06 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806547817 NA 5.60E-07 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806547817 NA 3.51E-07 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806547817 NA 1.61E-07 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806547817 NA 2.67E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806547817 NA 4.15E-09 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806547817 NA 7.87E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806547817 NA 4.72E-06 mr1177_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806547817 3.69E-06 1.81E-09 mr1180_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806547817 NA 3.78E-09 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806547817 NA 3.80E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806547817 NA 1.13E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251