Search for Variation information by Variation ID:
Detailed information for vg0806499371:
| Variant ID: vg0806499371 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 6499371 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
GCAGTTCTGGCAGAAGGATGGCCGCTCCGTTGCTAAGGCGCGCCTGCTTGAGCAGCTGGCGAAGGCGGAGGCGGCGGATCGGGGCGAGGAGCCGGCGGCC[G/A]
GCGGGGGCGGAGGCGATGCCGAGGATCACCCAGAGGTGTGAGGCCTTCCGCCCGCTTTTTATATTTTGTCGCTTTCTTTTGTGTTCGTCATGGAGGGCGA
Reverse complement sequence
TCGCCCTCCATGACGAACACAAAAGAAAGCGACAAAATATAAAAAGCGGGCGGAAGGCCTCACACCTCTGGGTGATCCTCGGCATCGCCTCCGCCCCCGC[C/T]
GGCCGCCGGCTCCTCGCCCCGATCCGCCGCCTCCGCCTTCGCCAGCTGCTCAAGCAGGCGCGCCTTAGCAACGGAGCGGCCATCCTTCTGCCAGAACTGC
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.90% | 5.60% | 3.87% | 16.65% | NA |
| All Indica | 2759 | 68.80% | 0.20% | 5.00% | 25.99% | NA |
| All Japonica | 1512 | 79.90% | 16.70% | 2.65% | 0.79% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 63.20% | 0.30% | 12.61% | 23.87% | NA |
| Indica II | 465 | 86.90% | 0.20% | 3.44% | 9.46% | NA |
| Indica III | 913 | 55.30% | 0.00% | 1.75% | 42.94% | NA |
| Indica Intermediate | 786 | 78.10% | 0.30% | 3.94% | 17.68% | NA |
| Temperate Japonica | 767 | 98.00% | 0.00% | 1.04% | 0.91% | NA |
| Tropical Japonica | 504 | 47.20% | 47.20% | 5.16% | 0.40% | NA |
| Japonica Intermediate | 241 | 90.50% | 5.80% | 2.49% | 1.24% | NA |
| VI/Aromatic | 96 | 52.10% | 0.00% | 0.00% | 47.92% | NA |
| Intermediate | 90 | 73.30% | 8.90% | 5.56% | 12.22% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0806499371 | G -> A | LOC_Os08g11040.1 | missense_variant ; p.Gly856Ser; MODERATE | nonsynonymous_codon ; G856S | Average:42.816; most accessible tissue: Minghui63 flag leaf, score: 80.516 | benign  |
1.26 |
TOLERATED | 0.31 |
| vg0806499371 | G -> DEL | LOC_Os08g11040.1 | N | frameshift_variant | Average:42.816; most accessible tissue: Minghui63 flag leaf, score: 80.516 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0806499371 | NA | 3.45E-07 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806499371 | NA | 1.07E-06 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806499371 | 2.31E-06 | 8.07E-10 | mr1510 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806499371 | 6.83E-06 | 7.17E-06 | mr1510 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806499371 | NA | 1.09E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806499371 | NA | 5.87E-20 | mr1676 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806499371 | NA | 2.36E-07 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806499371 | NA | 3.81E-07 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806499371 | NA | 4.28E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806499371 | NA | 6.12E-08 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806499371 | NA | 2.73E-09 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |