\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806496391:

Variant ID: vg0806496391 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 6496391
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTAATGTGTTGCAGTTTTTGCCCTTGGCGAATCGGCGAAGCTGGCTTTACTCCCTCGTTGGGCCGAGATCAACAGTGAAGGGCTTCCTTTTGCGGGCTC[G/A]
TCACTGTGCGGCTTGGTTGATGGGAATTTACCGTTTCGCCTCTCCTCAAGACACATGGCGGCTCGTGGTTGGGTAGGAAGGCGAACCGTCGCTTGGGTGG

Reverse complement sequence

CCACCCAAGCGACGGTTCGCCTTCCTACCCAACCACGAGCCGCCATGTGTCTTGAGGAGAGGCGAAACGGTAAATTCCCATCAACCAAGCCGCACAGTGA[C/T]
GAGCCCGCAAAAGGAAGCCCTTCACTGTTGATCTCGGCCCAACGAGGGAGTAAAGCCAGCTTCGCCGATTCGCCAAGGGCAAAAACTGCAACACATTACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.30% 5.80% 4.38% 27.59% NA
All Indica  2759 50.90% 0.30% 5.73% 43.13% NA
All Japonica  1512 78.80% 16.90% 2.45% 1.85% NA
Aus  269 95.20% 0.00% 1.86% 2.97% NA
Indica I  595 51.60% 0.20% 13.45% 34.79% NA
Indica II  465 68.20% 0.40% 4.30% 27.10% NA
Indica III  913 37.70% 0.20% 2.85% 59.26% NA
Indica Intermediate  786 55.30% 0.40% 4.07% 40.20% NA
Temperate Japonica  767 97.50% 0.10% 1.04% 1.30% NA
Tropical Japonica  504 45.00% 47.80% 4.76% 2.38% NA
Japonica Intermediate  241 89.60% 5.80% 2.07% 2.49% NA
VI/Aromatic  96 41.70% 0.00% 0.00% 58.33% NA
Intermediate  90 58.90% 8.90% 7.78% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0806496391 G -> A LOC_Os08g11030.1 upstream_gene_variant ; 428.0bp to feature; MODIFIER silent_mutation Average:33.702; most accessible tissue: Minghui63 flag leaf, score: 66.556 N N N N
vg0806496391 G -> A LOC_Os08g11040.1 upstream_gene_variant ; 255.0bp to feature; MODIFIER silent_mutation Average:33.702; most accessible tissue: Minghui63 flag leaf, score: 66.556 N N N N
vg0806496391 G -> A LOC_Os08g11020.1 downstream_gene_variant ; 2996.0bp to feature; MODIFIER silent_mutation Average:33.702; most accessible tissue: Minghui63 flag leaf, score: 66.556 N N N N
vg0806496391 G -> A LOC_Os08g11050.1 downstream_gene_variant ; 4325.0bp to feature; MODIFIER silent_mutation Average:33.702; most accessible tissue: Minghui63 flag leaf, score: 66.556 N N N N
vg0806496391 G -> A LOC_Os08g11030-LOC_Os08g11040 intergenic_region ; MODIFIER silent_mutation Average:33.702; most accessible tissue: Minghui63 flag leaf, score: 66.556 N N N N
vg0806496391 G -> DEL N N silent_mutation Average:33.702; most accessible tissue: Minghui63 flag leaf, score: 66.556 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0806496391 NA 1.55E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391 NA 1.56E-19 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391 NA 2.98E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391 NA 4.91E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391 7.25E-07 6.24E-23 mr1676 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391 NA 9.94E-10 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391 NA 1.16E-34 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391 NA 6.04E-16 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391 NA 7.11E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391 NA 8.48E-08 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391 4.63E-06 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391 1.81E-06 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391 NA 3.02E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391 NA 6.47E-21 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391 NA 1.26E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391 NA 1.96E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391 NA 4.60E-35 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391 NA 1.36E-17 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391 NA 1.13E-11 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391 NA 9.10E-12 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251