Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806496391:

Variant ID: vg0806496391 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 6496391
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTAATGTGTTGCAGTTTTTGCCCTTGGCGAATCGGCGAAGCTGGCTTTACTCCCTCGTTGGGCCGAGATCAACAGTGAAGGGCTTCCTTTTGCGGGCTC[G/A]
TCACTGTGCGGCTTGGTTGATGGGAATTTACCGTTTCGCCTCTCCTCAAGACACATGGCGGCTCGTGGTTGGGTAGGAAGGCGAACCGTCGCTTGGGTGG

Reverse complement sequence

CCACCCAAGCGACGGTTCGCCTTCCTACCCAACCACGAGCCGCCATGTGTCTTGAGGAGAGGCGAAACGGTAAATTCCCATCAACCAAGCCGCACAGTGA[C/T]
GAGCCCGCAAAAGGAAGCCCTTCACTGTTGATCTCGGCCCAACGAGGGAGTAAAGCCAGCTTCGCCGATTCGCCAAGGGCAAAAACTGCAACACATTACT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.30%	5.80%	4.38%	27.59%	NA
All Indica	2759	50.90%	0.30%	5.73%	43.13%	NA
All Japonica	1512	78.80%	16.90%	2.45%	1.85%	NA
Aus	269	95.20%	0.00%	1.86%	2.97%	NA
Indica I	595	51.60%	0.20%	13.45%	34.79%	NA
Indica II	465	68.20%	0.40%	4.30%	27.10%	NA
Indica III	913	37.70%	0.20%	2.85%	59.26%	NA
Indica Intermediate	786	55.30%	0.40%	4.07%	40.20%	NA
Temperate Japonica	767	97.50%	0.10%	1.04%	1.30%	NA
Tropical Japonica	504	45.00%	47.80%	4.76%	2.38%	NA
Japonica Intermediate	241	89.60%	5.80%	2.07%	2.49%	NA
VI/Aromatic	96	41.70%	0.00%	0.00%	58.33%	NA
Intermediate	90	58.90%	8.90%	7.78%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0806496391	G -> A	LOC_Os08g11030.1	upstream_gene_variant ; 428.0bp to feature; MODIFIER	silent_mutation	Average:33.702; most accessible tissue: Minghui63 flag leaf, score: 66.556	N	N	N	N
vg0806496391	G -> A	LOC_Os08g11040.1	upstream_gene_variant ; 255.0bp to feature; MODIFIER	silent_mutation	Average:33.702; most accessible tissue: Minghui63 flag leaf, score: 66.556	N	N	N	N
vg0806496391	G -> A	LOC_Os08g11020.1	downstream_gene_variant ; 2996.0bp to feature; MODIFIER	silent_mutation	Average:33.702; most accessible tissue: Minghui63 flag leaf, score: 66.556	N	N	N	N
vg0806496391	G -> A	LOC_Os08g11050.1	downstream_gene_variant ; 4325.0bp to feature; MODIFIER	silent_mutation	Average:33.702; most accessible tissue: Minghui63 flag leaf, score: 66.556	N	N	N	N
vg0806496391	G -> A	LOC_Os08g11030-LOC_Os08g11040	intergenic_region ; MODIFIER	silent_mutation	Average:33.702; most accessible tissue: Minghui63 flag leaf, score: 66.556	N	N	N	N
vg0806496391	G -> DEL	N	N	silent_mutation	Average:33.702; most accessible tissue: Minghui63 flag leaf, score: 66.556	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0806496391	NA	1.55E-07	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391	NA	1.56E-19	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391	NA	2.98E-06	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391	NA	4.91E-09	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391	7.25E-07	6.24E-23	mr1676	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391	NA	9.94E-10	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391	NA	1.16E-34	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391	NA	6.04E-16	mr1699	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391	NA	7.11E-10	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391	NA	8.48E-08	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391	4.63E-06	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391	1.81E-06	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391	NA	3.02E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391	NA	6.47E-21	mr1676_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391	NA	1.26E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391	NA	1.96E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391	NA	4.60E-35	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391	NA	1.36E-17	mr1699_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391	NA	1.13E-11	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806496391	NA	9.10E-12	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251