Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806485055:

Variant ID: vg0806485055 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 6485055
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

ACATTTGAATTTTTCTTGTACGTATTTTAGTGTTTGCCAATTTCTTTCCGAATTTTAATTAATTCTATTATTCCTTTTGGAAAATGATTTTTATTTCGGG[T/A]
TGAATTTATCAGGACGTGACAAATCCACCCCCCTTACAGGAATCTCGTCCCCGAGATTCGAGGAGGCTAGCAAGAAGATAGGTTGGGCGGTCTTCTCCTC

Reverse complement sequence

GAGGAGAAGACCGCCCAACCTATCTTCTTGCTAGCCTCCTCGAATCTCGGGGACGAGATTCCTGTAAGGGGGGTGGATTTGTCACGTCCTGATAAATTCA[A/T]
CCCGAAATAAAAATCATTTTCCAAAAGGAATAATAGAATTAATTAAAATTCGGAAAGAAATTGGCAAACACTAAAATACGTACAAGAAAAATTCAAATGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.70%	8.30%	22.73%	31.19%	NA
All Indica	2759	18.80%	2.40%	35.23%	43.60%	NA
All Japonica	1512	75.50%	21.40%	2.12%	1.06%	NA
Aus	269	13.00%	0.00%	11.52%	75.46%	NA
Indica I	595	33.30%	8.10%	19.50%	39.16%	NA
Indica II	465	11.80%	0.40%	30.54%	57.20%	NA
Indica III	913	11.10%	0.30%	52.68%	35.93%	NA
Indica Intermediate	786	20.90%	1.70%	29.64%	47.84%	NA
Temperate Japonica	767	57.00%	38.90%	3.13%	1.04%	NA
Tropical Japonica	504	97.20%	0.40%	1.59%	0.79%	NA
Japonica Intermediate	241	88.80%	9.50%	0.00%	1.66%	NA
VI/Aromatic	96	40.60%	1.00%	27.08%	31.25%	NA
Intermediate	90	56.70%	4.40%	14.44%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0806485055	T -> A	LOC_Os08g10990.1	upstream_gene_variant ; 4700.0bp to feature; MODIFIER	silent_mutation	Average:7.876; most accessible tissue: Minghui63 root, score: 13.235	N	N	N	N
vg0806485055	T -> A	LOC_Os08g11000.1	upstream_gene_variant ; 2245.0bp to feature; MODIFIER	silent_mutation	Average:7.876; most accessible tissue: Minghui63 root, score: 13.235	N	N	N	N
vg0806485055	T -> A	LOC_Os08g11010.1	downstream_gene_variant ; 2868.0bp to feature; MODIFIER	silent_mutation	Average:7.876; most accessible tissue: Minghui63 root, score: 13.235	N	N	N	N
vg0806485055	T -> A	LOC_Os08g11000-LOC_Os08g11010	intergenic_region ; MODIFIER	silent_mutation	Average:7.876; most accessible tissue: Minghui63 root, score: 13.235	N	N	N	N
vg0806485055	T -> DEL	N	N	silent_mutation	Average:7.876; most accessible tissue: Minghui63 root, score: 13.235	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0806485055	NA	1.12E-17	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055	NA	5.15E-08	mr1035	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055	NA	1.25E-15	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055	NA	5.92E-06	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055	NA	9.38E-07	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055	NA	2.15E-13	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055	NA	1.63E-06	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055	NA	4.88E-10	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055	NA	1.57E-22	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055	NA	1.38E-08	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055	NA	3.33E-06	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055	NA	8.54E-06	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055	NA	7.33E-08	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055	NA	2.35E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055	NA	1.48E-18	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251