\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806485055:

Variant ID: vg0806485055 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 6485055
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


ACATTTGAATTTTTCTTGTACGTATTTTAGTGTTTGCCAATTTCTTTCCGAATTTTAATTAATTCTATTATTCCTTTTGGAAAATGATTTTTATTTCGGG[T/A]
TGAATTTATCAGGACGTGACAAATCCACCCCCCTTACAGGAATCTCGTCCCCGAGATTCGAGGAGGCTAGCAAGAAGATAGGTTGGGCGGTCTTCTCCTC

Reverse complement sequence

GAGGAGAAGACCGCCCAACCTATCTTCTTGCTAGCCTCCTCGAATCTCGGGGACGAGATTCCTGTAAGGGGGGTGGATTTGTCACGTCCTGATAAATTCA[A/T]
CCCGAAATAAAAATCATTTTCCAAAAGGAATAATAGAATTAATTAAAATTCGGAAAGAAATTGGCAAACACTAAAATACGTACAAGAAAAATTCAAATGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.70% 8.30% 22.73% 31.19% NA
All Indica  2759 18.80% 2.40% 35.23% 43.60% NA
All Japonica  1512 75.50% 21.40% 2.12% 1.06% NA
Aus  269 13.00% 0.00% 11.52% 75.46% NA
Indica I  595 33.30% 8.10% 19.50% 39.16% NA
Indica II  465 11.80% 0.40% 30.54% 57.20% NA
Indica III  913 11.10% 0.30% 52.68% 35.93% NA
Indica Intermediate  786 20.90% 1.70% 29.64% 47.84% NA
Temperate Japonica  767 57.00% 38.90% 3.13% 1.04% NA
Tropical Japonica  504 97.20% 0.40% 1.59% 0.79% NA
Japonica Intermediate  241 88.80% 9.50% 0.00% 1.66% NA
VI/Aromatic  96 40.60% 1.00% 27.08% 31.25% NA
Intermediate  90 56.70% 4.40% 14.44% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0806485055 T -> A LOC_Os08g10990.1 upstream_gene_variant ; 4700.0bp to feature; MODIFIER silent_mutation Average:7.876; most accessible tissue: Minghui63 root, score: 13.235 N N N N
vg0806485055 T -> A LOC_Os08g11000.1 upstream_gene_variant ; 2245.0bp to feature; MODIFIER silent_mutation Average:7.876; most accessible tissue: Minghui63 root, score: 13.235 N N N N
vg0806485055 T -> A LOC_Os08g11010.1 downstream_gene_variant ; 2868.0bp to feature; MODIFIER silent_mutation Average:7.876; most accessible tissue: Minghui63 root, score: 13.235 N N N N
vg0806485055 T -> A LOC_Os08g11000-LOC_Os08g11010 intergenic_region ; MODIFIER silent_mutation Average:7.876; most accessible tissue: Minghui63 root, score: 13.235 N N N N
vg0806485055 T -> DEL N N silent_mutation Average:7.876; most accessible tissue: Minghui63 root, score: 13.235 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0806485055 NA 1.12E-17 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055 NA 5.15E-08 mr1035 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055 NA 1.25E-15 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055 NA 5.92E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055 NA 9.38E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055 NA 2.15E-13 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055 NA 1.63E-06 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055 NA 4.88E-10 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055 NA 1.57E-22 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055 NA 1.38E-08 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055 NA 3.33E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055 NA 8.54E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055 NA 7.33E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055 NA 2.35E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806485055 NA 1.48E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251