Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0806462678:

Variant ID: vg0806462678 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 6462678
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCGTAATATACAAGGAAACGTAACACCCAAGTCATGATCTGTTACATATTACATAGATATAAGTTATCCCCTATGACTAGTCGGATAACCATGCCGTAT[G/A]
GGTATGGGGTACCCATAATATCCACACATGTCAAACAAAGTTTGGTACTAGATTGCTTAATCCTCTTAGAGCTAATCAAGTTAAATATCGAGCTAGCAAA

Reverse complement sequence

TTTGCTAGCTCGATATTTAACTTGATTAGCTCTAAGAGGATTAAGCAATCTAGTACCAAACTTTGTTTGACATGTGTGGATATTATGGGTACCCCATACC[C/T]
ATACGGCATGGTTATCCGACTAGTCATAGGGGATAACTTATATCTATGTAATATGTAACAGATCATGACTTGGGTGTTACGTTTCCTTGTATATTACGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.00%	7.30%	7.60%	21.07%	NA
All Indica	2759	62.10%	0.50%	10.87%	26.50%	NA
All Japonica	1512	74.50%	21.10%	2.78%	1.59%	NA
Aus	269	19.00%	0.00%	3.72%	77.32%	NA
Indica I	595	54.80%	0.80%	20.00%	24.37%	NA
Indica II	465	37.60%	0.90%	10.75%	50.75%	NA
Indica III	913	81.20%	0.20%	3.61%	15.01%	NA
Indica Intermediate	786	59.90%	0.50%	12.47%	27.10%	NA
Temperate Japonica	767	97.50%	0.00%	1.30%	1.17%	NA
Tropical Japonica	504	32.30%	59.90%	5.75%	1.98%	NA
Japonica Intermediate	241	89.60%	7.10%	1.24%	2.07%	NA
VI/Aromatic	96	81.20%	0.00%	2.08%	16.67%	NA
Intermediate	90	62.20%	13.30%	5.56%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0806462678	G -> A	LOC_Os08g10970.1	upstream_gene_variant ; 4265.0bp to feature; MODIFIER	silent_mutation	Average:18.268; most accessible tissue: Callus, score: 50.909	N	N	N	N
vg0806462678	G -> A	LOC_Os08g10950.1	downstream_gene_variant ; 3771.0bp to feature; MODIFIER	silent_mutation	Average:18.268; most accessible tissue: Callus, score: 50.909	N	N	N	N
vg0806462678	G -> A	LOC_Os08g10960.1	downstream_gene_variant ; 319.0bp to feature; MODIFIER	silent_mutation	Average:18.268; most accessible tissue: Callus, score: 50.909	N	N	N	N
vg0806462678	G -> A	LOC_Os08g10950-LOC_Os08g10960	intergenic_region ; MODIFIER	silent_mutation	Average:18.268; most accessible tissue: Callus, score: 50.909	N	N	N	N
vg0806462678	G -> DEL	N	N	silent_mutation	Average:18.268; most accessible tissue: Callus, score: 50.909	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0806462678	NA	3.05E-06	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806462678	NA	2.31E-08	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806462678	NA	2.19E-06	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806462678	3.74E-06	NA	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806462678	NA	4.45E-16	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806462678	NA	1.40E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806462678	NA	2.53E-30	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806462678	1.62E-07	NA	mr1850_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806462678	NA	3.21E-08	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806462678	NA	1.69E-10	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251