\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806462678:

Variant ID: vg0806462678 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 6462678
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCGTAATATACAAGGAAACGTAACACCCAAGTCATGATCTGTTACATATTACATAGATATAAGTTATCCCCTATGACTAGTCGGATAACCATGCCGTAT[G/A]
GGTATGGGGTACCCATAATATCCACACATGTCAAACAAAGTTTGGTACTAGATTGCTTAATCCTCTTAGAGCTAATCAAGTTAAATATCGAGCTAGCAAA

Reverse complement sequence

TTTGCTAGCTCGATATTTAACTTGATTAGCTCTAAGAGGATTAAGCAATCTAGTACCAAACTTTGTTTGACATGTGTGGATATTATGGGTACCCCATACC[C/T]
ATACGGCATGGTTATCCGACTAGTCATAGGGGATAACTTATATCTATGTAATATGTAACAGATCATGACTTGGGTGTTACGTTTCCTTGTATATTACGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.00% 7.30% 7.60% 21.07% NA
All Indica  2759 62.10% 0.50% 10.87% 26.50% NA
All Japonica  1512 74.50% 21.10% 2.78% 1.59% NA
Aus  269 19.00% 0.00% 3.72% 77.32% NA
Indica I  595 54.80% 0.80% 20.00% 24.37% NA
Indica II  465 37.60% 0.90% 10.75% 50.75% NA
Indica III  913 81.20% 0.20% 3.61% 15.01% NA
Indica Intermediate  786 59.90% 0.50% 12.47% 27.10% NA
Temperate Japonica  767 97.50% 0.00% 1.30% 1.17% NA
Tropical Japonica  504 32.30% 59.90% 5.75% 1.98% NA
Japonica Intermediate  241 89.60% 7.10% 1.24% 2.07% NA
VI/Aromatic  96 81.20% 0.00% 2.08% 16.67% NA
Intermediate  90 62.20% 13.30% 5.56% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0806462678 G -> A LOC_Os08g10970.1 upstream_gene_variant ; 4265.0bp to feature; MODIFIER silent_mutation Average:18.268; most accessible tissue: Callus, score: 50.909 N N N N
vg0806462678 G -> A LOC_Os08g10950.1 downstream_gene_variant ; 3771.0bp to feature; MODIFIER silent_mutation Average:18.268; most accessible tissue: Callus, score: 50.909 N N N N
vg0806462678 G -> A LOC_Os08g10960.1 downstream_gene_variant ; 319.0bp to feature; MODIFIER silent_mutation Average:18.268; most accessible tissue: Callus, score: 50.909 N N N N
vg0806462678 G -> A LOC_Os08g10950-LOC_Os08g10960 intergenic_region ; MODIFIER silent_mutation Average:18.268; most accessible tissue: Callus, score: 50.909 N N N N
vg0806462678 G -> DEL N N silent_mutation Average:18.268; most accessible tissue: Callus, score: 50.909 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0806462678 NA 3.05E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806462678 NA 2.31E-08 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806462678 NA 2.19E-06 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806462678 3.74E-06 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806462678 NA 4.45E-16 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806462678 NA 1.40E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806462678 NA 2.53E-30 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806462678 1.62E-07 NA mr1850_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806462678 NA 3.21E-08 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806462678 NA 1.69E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251