\
| Variant ID: vg0806462678 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 6462678 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCCGTAATATACAAGGAAACGTAACACCCAAGTCATGATCTGTTACATATTACATAGATATAAGTTATCCCCTATGACTAGTCGGATAACCATGCCGTAT[G/A]
GGTATGGGGTACCCATAATATCCACACATGTCAAACAAAGTTTGGTACTAGATTGCTTAATCCTCTTAGAGCTAATCAAGTTAAATATCGAGCTAGCAAA
TTTGCTAGCTCGATATTTAACTTGATTAGCTCTAAGAGGATTAAGCAATCTAGTACCAAACTTTGTTTGACATGTGTGGATATTATGGGTACCCCATACC[C/T]
ATACGGCATGGTTATCCGACTAGTCATAGGGGATAACTTATATCTATGTAATATGTAACAGATCATGACTTGGGTGTTACGTTTCCTTGTATATTACGGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.00% | 7.30% | 7.60% | 21.07% | NA |
| All Indica | 2759 | 62.10% | 0.50% | 10.87% | 26.50% | NA |
| All Japonica | 1512 | 74.50% | 21.10% | 2.78% | 1.59% | NA |
| Aus | 269 | 19.00% | 0.00% | 3.72% | 77.32% | NA |
| Indica I | 595 | 54.80% | 0.80% | 20.00% | 24.37% | NA |
| Indica II | 465 | 37.60% | 0.90% | 10.75% | 50.75% | NA |
| Indica III | 913 | 81.20% | 0.20% | 3.61% | 15.01% | NA |
| Indica Intermediate | 786 | 59.90% | 0.50% | 12.47% | 27.10% | NA |
| Temperate Japonica | 767 | 97.50% | 0.00% | 1.30% | 1.17% | NA |
| Tropical Japonica | 504 | 32.30% | 59.90% | 5.75% | 1.98% | NA |
| Japonica Intermediate | 241 | 89.60% | 7.10% | 1.24% | 2.07% | NA |
| VI/Aromatic | 96 | 81.20% | 0.00% | 2.08% | 16.67% | NA |
| Intermediate | 90 | 62.20% | 13.30% | 5.56% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0806462678 | G -> A | LOC_Os08g10970.1 | upstream_gene_variant ; 4265.0bp to feature; MODIFIER | silent_mutation | Average:18.268; most accessible tissue: Callus, score: 50.909 | N | N | N | N |
| vg0806462678 | G -> A | LOC_Os08g10950.1 | downstream_gene_variant ; 3771.0bp to feature; MODIFIER | silent_mutation | Average:18.268; most accessible tissue: Callus, score: 50.909 | N | N | N | N |
| vg0806462678 | G -> A | LOC_Os08g10960.1 | downstream_gene_variant ; 319.0bp to feature; MODIFIER | silent_mutation | Average:18.268; most accessible tissue: Callus, score: 50.909 | N | N | N | N |
| vg0806462678 | G -> A | LOC_Os08g10950-LOC_Os08g10960 | intergenic_region ; MODIFIER | silent_mutation | Average:18.268; most accessible tissue: Callus, score: 50.909 | N | N | N | N |
| vg0806462678 | G -> DEL | N | N | silent_mutation | Average:18.268; most accessible tissue: Callus, score: 50.909 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0806462678 | NA | 3.05E-06 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806462678 | NA | 2.31E-08 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806462678 | NA | 2.19E-06 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806462678 | 3.74E-06 | NA | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806462678 | NA | 4.45E-16 | mr1334_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806462678 | NA | 1.40E-06 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806462678 | NA | 2.53E-30 | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806462678 | 1.62E-07 | NA | mr1850_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806462678 | NA | 3.21E-08 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806462678 | NA | 1.69E-10 | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |