Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0806428787:

Variant ID: vg0806428787 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 6428787
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

AAAATCCGTGGTCCCACCAGGCGTGCCAAAAATGTGTTGATGCGAAAAACACACACTGGCCTGGGACATCTGCTTAGCTCCAGTGCAGGTCCAAAGGTTG[A/G]
TGAGGTGCGGGCATGCCAGTCAGTTTGATCCTGCAACTGACAAGATATGTAAACCGTAGATCAAATAGCCGATCGGTTGACAAGCCGATGGAGTAGTTCC

Reverse complement sequence

GGAACTACTCCATCGGCTTGTCAACCGATCGGCTATTTGATCTACGGTTTACATATCTTGTCAGTTGCAGGATCAAACTGACTGGCATGCCCGCACCTCA[T/C]
CAACCTTTGGACCTGCACTGGAGCTAAGCAGATGTCCCAGGCCAGTGTGTGTTTTTCGCATCAACACATTTTTGGCACGCCTGGTGGGACCACGGATTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.60%	15.50%	4.59%	0.32%	NA
All Indica	2759	65.90%	26.40%	7.32%	0.47%	NA
All Japonica	1512	99.10%	0.20%	0.60%	0.13%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	62.90%	31.40%	5.71%	0.00%	NA
Indica II	465	68.40%	23.00%	7.10%	1.51%	NA
Indica III	913	61.20%	28.80%	9.64%	0.33%	NA
Indica Intermediate	786	72.00%	21.60%	5.98%	0.38%	NA
Temperate Japonica	767	99.50%	0.00%	0.39%	0.13%	NA
Tropical Japonica	504	98.40%	0.20%	1.19%	0.20%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	2.20%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0806428787	A -> G	LOC_Os08g10900.1	upstream_gene_variant ; 109.0bp to feature; MODIFIER	silent_mutation	Average:47.246; most accessible tissue: Minghui63 flag leaf, score: 78.154	N	N	N	N
vg0806428787	A -> G	LOC_Os08g10910.1	downstream_gene_variant ; 1390.0bp to feature; MODIFIER	silent_mutation	Average:47.246; most accessible tissue: Minghui63 flag leaf, score: 78.154	N	N	N	N
vg0806428787	A -> G	LOC_Os08g10920.1	downstream_gene_variant ; 3439.0bp to feature; MODIFIER	silent_mutation	Average:47.246; most accessible tissue: Minghui63 flag leaf, score: 78.154	N	N	N	N
vg0806428787	A -> G	LOC_Os08g10900-LOC_Os08g10910	intergenic_region ; MODIFIER	silent_mutation	Average:47.246; most accessible tissue: Minghui63 flag leaf, score: 78.154	N	N	N	N
vg0806428787	A -> DEL	N	N	silent_mutation	Average:47.246; most accessible tissue: Minghui63 flag leaf, score: 78.154	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0806428787	NA	9.31E-06	mr1074_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806428787	NA	6.93E-08	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806428787	NA	1.83E-09	mr1220_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806428787	NA	4.64E-07	mr1242_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806428787	NA	3.21E-07	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806428787	NA	2.73E-06	mr1863_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251