Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0806378465:

Variant ID: vg0806378465 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 6378465
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

ATGCAGTCACTAGAACAATGCCAGCTATATCTCTCCAGAATCAAAATGAGCAGCCATATTTGTGGTTTTCAGTTCGCTACCTATCATTGTGTAATCGAAA[G/C]
TTTGCAGCAATCATGTAATACATAAATATATTCATGTCTATAAACAGTGAGCTTGCTATGCTTATGGATGATTCATGTTGAAGATACAATGTACCGATGT

Reverse complement sequence

ACATCGGTACATTGTATCTTCAACATGAATCATCCATAAGCATAGCAAGCTCACTGTTTATAGACATGAATATATTTATGTATTACATGATTGCTGCAAA[C/G]
TTTCGATTACACAATGATAGGTAGCGAACTGAAAACCACAAATATGGCTGCTCATTTTGATTCTGGAGAGATATAGCTGGCATTGTTCTAGTGACTGCAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.10%	1.70%	1.23%	4.02%	NA
All Indica	2759	95.70%	0.00%	0.22%	4.06%	NA
All Japonica	1512	91.30%	5.10%	3.17%	0.46%	NA
Aus	269	75.10%	0.00%	1.49%	23.42%	NA
Indica I	595	98.20%	0.20%	0.67%	1.01%	NA
Indica II	465	94.00%	0.00%	0.00%	6.02%	NA
Indica III	913	94.90%	0.00%	0.00%	5.15%	NA
Indica Intermediate	786	95.80%	0.00%	0.25%	3.94%	NA
Temperate Japonica	767	85.30%	8.30%	5.74%	0.65%	NA
Tropical Japonica	504	99.60%	0.00%	0.00%	0.40%	NA
Japonica Intermediate	241	92.90%	5.40%	1.66%	0.00%	NA
VI/Aromatic	96	94.80%	0.00%	0.00%	5.21%	NA
Intermediate	90	95.60%	1.10%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0806378465	G -> C	LOC_Os08g10840.1	upstream_gene_variant ; 4202.0bp to feature; MODIFIER	silent_mutation	Average:28.659; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N
vg0806378465	G -> C	LOC_Os08g10830.1	downstream_gene_variant ; 1028.0bp to feature; MODIFIER	silent_mutation	Average:28.659; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N
vg0806378465	G -> C	LOC_Os08g10830-LOC_Os08g10840	intergenic_region ; MODIFIER	silent_mutation	Average:28.659; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N
vg0806378465	G -> DEL	N	N	silent_mutation	Average:28.659; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0806378465	NA	2.94E-06	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806378465	NA	7.81E-07	mr1648	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806378465	NA	3.64E-06	mr1697	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806378465	3.07E-06	3.07E-06	mr1172_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806378465	NA	4.05E-06	mr1296_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806378465	NA	2.94E-06	mr1358_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251