| Variant ID: vg0806359100 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 6359100 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 241. )
CATCTCCAACGCCGTCGATGCTTCCTGGACCTCTCCGACCCCTTTCAGCTGCACGGTGAGACACTGCATACCCCTGAACACCCCATGCATGCACCCATAT[A/C]
GCCCATTCAGAGCTGTAGCTCGACACGCATGCACATACCAAGAACCACCGCCGCTGTAGCTTGTTTTTCGCGAGCTACAGACCACCGCTGTAGCTGTAGC
GCTACAGCTACAGCGGTGGTCTGTAGCTCGCGAAAAACAAGCTACAGCGGCGGTGGTTCTTGGTATGTGCATGCGTGTCGAGCTACAGCTCTGAATGGGC[T/G]
ATATGGGTGCATGCATGGGGTGTTCAGGGGTATGCAGTGTCTCACCGTGCAGCTGAAAGGGGTCGGAGAGGTCCAGGAAGCATCGACGGCGTTGGAGATG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.00% | 2.90% | 1.59% | 7.51% | NA |
| All Indica | 2759 | 80.60% | 5.00% | 2.43% | 11.96% | NA |
| All Japonica | 1512 | 99.30% | 0.00% | 0.13% | 0.60% | NA |
| Aus | 269 | 98.10% | 0.00% | 1.86% | 0.00% | NA |
| Indica I | 595 | 79.50% | 13.10% | 3.03% | 4.37% | NA |
| Indica II | 465 | 71.00% | 1.10% | 1.94% | 26.02% | NA |
| Indica III | 913 | 82.80% | 3.00% | 2.08% | 12.16% | NA |
| Indica Intermediate | 786 | 84.60% | 3.60% | 2.67% | 9.16% | NA |
| Temperate Japonica | 767 | 99.50% | 0.00% | 0.13% | 0.39% | NA |
| Tropical Japonica | 504 | 98.80% | 0.00% | 0.20% | 0.99% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 85.40% | 0.00% | 1.04% | 13.54% | NA |
| Intermediate | 90 | 96.70% | 0.00% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0806359100 | A -> C | LOC_Os08g10790.1 | downstream_gene_variant ; 2935.0bp to feature; MODIFIER | silent_mutation | Average:15.757; most accessible tissue: Callus, score: 43.373 | N | N | N | N |
| vg0806359100 | A -> C | LOC_Os08g10800.1 | intron_variant ; MODIFIER | silent_mutation | Average:15.757; most accessible tissue: Callus, score: 43.373 | N | N | N | N |
| vg0806359100 | A -> DEL | N | N | silent_mutation | Average:15.757; most accessible tissue: Callus, score: 43.373 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0806359100 | 3.80E-08 | 1.09E-11 | mr1038 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359100 | 4.94E-08 | 1.37E-11 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359100 | 9.28E-08 | 7.51E-12 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359100 | 1.40E-07 | 6.82E-11 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359100 | 6.67E-09 | 7.85E-14 | mr1038_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359100 | 2.72E-08 | 1.84E-12 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359100 | 4.57E-06 | NA | mr1141_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359100 | 5.43E-06 | NA | mr1141_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359100 | 2.16E-06 | 1.66E-09 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359100 | 3.23E-06 | 3.54E-09 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |