\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806333851:

Variant ID: vg0806333851 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 6333851
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTTGGGAGAATCTACCAATAGAAGCTGCTACCTGGGAGGATGCATCCTTTATATCCAAGACTTTTCCCTGGTTTAACCCATGAGGACCTGGGTCTTAA[T/G]
GGGGGAGGCATTGTCAGGCCCTGCTTATCTGAAGAAGTTGTTTATCAGAAAGAGAAATAGGAGTTGCGGGAATGGGCAGCCCAGATGCTAAGATACCAGT

Reverse complement sequence

ACTGGTATCTTAGCATCTGGGCTGCCCATTCCCGCAACTCCTATTTCTCTTTCTGATAAACAACTTCTTCAGATAAGCAGGGCCTGACAATGCCTCCCCC[A/C]
TTAAGACCCAGGTCCTCATGGGTTAAACCAGGGAAAAGTCTTGGATATAAAGGATGCATCCTCCCAGGTAGCAGCTTCTATTGGTAGATTCTCCCAAAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.60% 31.30% 0.51% 35.65% NA
All Indica  2759 35.70% 4.00% 0.76% 59.51% NA
All Japonica  1512 11.20% 87.70% 0.13% 0.99% NA
Aus  269 98.50% 0.40% 0.00% 1.12% NA
Indica I  595 15.10% 9.40% 0.84% 74.62% NA
Indica II  465 49.00% 3.90% 1.08% 46.02% NA
Indica III  913 35.20% 0.90% 0.44% 63.53% NA
Indica Intermediate  786 44.10% 3.60% 0.89% 51.40% NA
Temperate Japonica  767 16.70% 81.90% 0.26% 1.17% NA
Tropical Japonica  504 2.80% 96.40% 0.00% 0.79% NA
Japonica Intermediate  241 11.20% 88.00% 0.00% 0.83% NA
VI/Aromatic  96 95.80% 3.10% 0.00% 1.04% NA
Intermediate  90 31.10% 41.10% 1.11% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0806333851 T -> G LOC_Os08g10780.1 upstream_gene_variant ; 438.0bp to feature; MODIFIER silent_mutation Average:52.981; most accessible tissue: Minghui63 root, score: 84.323 N N N N
vg0806333851 T -> G LOC_Os08g10770.1 downstream_gene_variant ; 16.0bp to feature; MODIFIER silent_mutation Average:52.981; most accessible tissue: Minghui63 root, score: 84.323 N N N N
vg0806333851 T -> G LOC_Os08g10770-LOC_Os08g10780 intergenic_region ; MODIFIER silent_mutation Average:52.981; most accessible tissue: Minghui63 root, score: 84.323 N N N N
vg0806333851 T -> DEL N N silent_mutation Average:52.981; most accessible tissue: Minghui63 root, score: 84.323 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0806333851 T G 0.02 0.01 0.01 0.02 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0806333851 4.06E-06 NA mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 2.73E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 2.91E-09 3.64E-21 mr1062 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 5.27E-07 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 9.00E-24 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 2.28E-43 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 3.75E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 1.08E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 1.08E-25 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 2.19E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 2.92E-17 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 1.03E-12 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 7.04E-20 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 9.58E-06 NA mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 9.36E-22 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 5.75E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 1.37E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 9.29E-06 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 2.13E-15 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 8.91E-06 mr1221_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 2.01E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 1.03E-18 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 5.17E-26 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 2.76E-27 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 1.14E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 2.13E-11 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 1.05E-08 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806333851 NA 2.12E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251