\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806320144:

Variant ID: vg0806320144 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 6320144
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 359. )

Flanking Sequence (100 bp) in Reference Genome:


TGGAAATGTTGAGCATTTGAATGAAGATATTGGCTGCAATGTTGAGCATTTGAATGAAGATGTTAGCTGCAATGTTGAATTTGAGACGAATGAGCCTCCG[G/A]
ATGACCCAGAAGATGATCAAATGTACCGTATGGTACAGGATCTGTACCCAGATCAAAATCATGGACCAAGAACAAAGTCAAAGTTTGCCACCATATTAGA

Reverse complement sequence

TCTAATATGGTGGCAAACTTTGACTTTGTTCTTGGTCCATGATTTTGATCTGGGTACAGATCCTGTACCATACGGTACATTTGATCATCTTCTGGGTCAT[C/T]
CGGAGGCTCATTCGTCTCAAATTCAACATTGCAGCTAACATCTTCATTCAAATGCTCAACATTGCAGCCAATATCTTCATTCAAATGCTCAACATTTCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.40% 2.90% 3.79% 16.91% NA
All Indica  2759 65.20% 0.00% 6.42% 28.38% NA
All Japonica  1512 90.50% 8.90% 0.13% 0.46% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 50.80% 0.20% 6.05% 43.03% NA
Indica II  465 71.40% 0.00% 4.30% 24.30% NA
Indica III  913 66.20% 0.00% 7.78% 26.07% NA
Indica Intermediate  786 71.20% 0.00% 6.36% 22.39% NA
Temperate Japonica  767 84.10% 15.00% 0.26% 0.65% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 90.90% 8.30% 0.00% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 0.00% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0806320144 G -> A LOC_Os08g10740.1 missense_variant ; p.Asp115Asn; MODERATE nonsynonymous_codon ; D115N Average:61.199; most accessible tissue: Minghui63 flag leaf, score: 95.189 unknown unknown TOLERATED 0.15
vg0806320144 G -> A LOC_Os08g10740.2 missense_variant ; p.Asp115Asn; MODERATE nonsynonymous_codon ; D115N Average:61.199; most accessible tissue: Minghui63 flag leaf, score: 95.189 unknown unknown TOLERATED 0.15
vg0806320144 G -> DEL LOC_Os08g10740.2 N frameshift_variant Average:61.199; most accessible tissue: Minghui63 flag leaf, score: 95.189 N N N N
vg0806320144 G -> DEL LOC_Os08g10740.1 N frameshift_variant Average:61.199; most accessible tissue: Minghui63 flag leaf, score: 95.189 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0806320144 G A -0.02 -0.02 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0806320144 6.36E-07 NA mr1002 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806320144 NA 2.87E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806320144 9.74E-07 NA mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806320144 NA 6.97E-07 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806320144 NA 2.88E-06 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806320144 NA 5.57E-06 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251