\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806234971:

Variant ID: vg0806234971 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 6234971
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATAGTATAGTCCACTGCTAGCTCTAAATCATCTATAGCTAATGTAATAACCAATTCATACAATAGTTGCTTACTATACTATTAATATTTGGTCACATCT[G/A]
TCATACACACGTTATATCTTGAAGTCTGTGCTGTAGCTGGCTACAGATCTGTAGCCCGCTGCTCTTCTCTCTTCCTTTATCTCTTTAAAATATGGTTATA

Reverse complement sequence

TATAACCATATTTTAAAGAGATAAAGGAAGAGAGAAGAGCAGCGGGCTACAGATCTGTAGCCAGCTACAGCACAGACTTCAAGATATAACGTGTGTATGA[C/T]
AGATGTGACCAAATATTAATAGTATAGTAAGCAACTATTGTATGAATTGGTTATTACATTAGCTATAGATGATTTAGAGCTAGCAGTGGACTATACTATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.20% 8.30% 0.59% 0.00% NA
All Indica  2759 99.80% 0.10% 0.07% 0.00% NA
All Japonica  1512 73.60% 24.70% 1.72% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.10% 0.13% 0.00% NA
Temperate Japonica  767 97.80% 1.00% 1.17% 0.00% NA
Tropical Japonica  504 43.80% 54.60% 1.59% 0.00% NA
Japonica Intermediate  241 58.90% 37.30% 3.73% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0806234971 G -> A LOC_Os08g10600.1 upstream_gene_variant ; 2478.0bp to feature; MODIFIER silent_mutation Average:78.023; most accessible tissue: Zhenshan97 panicle, score: 95.493 N N N N
vg0806234971 G -> A LOC_Os08g10600.2 upstream_gene_variant ; 2478.0bp to feature; MODIFIER silent_mutation Average:78.023; most accessible tissue: Zhenshan97 panicle, score: 95.493 N N N N
vg0806234971 G -> A LOC_Os08g10600.3 upstream_gene_variant ; 2478.0bp to feature; MODIFIER silent_mutation Average:78.023; most accessible tissue: Zhenshan97 panicle, score: 95.493 N N N N
vg0806234971 G -> A LOC_Os08g10580.1 downstream_gene_variant ; 3669.0bp to feature; MODIFIER silent_mutation Average:78.023; most accessible tissue: Zhenshan97 panicle, score: 95.493 N N N N
vg0806234971 G -> A LOC_Os08g10590.1 downstream_gene_variant ; 838.0bp to feature; MODIFIER silent_mutation Average:78.023; most accessible tissue: Zhenshan97 panicle, score: 95.493 N N N N
vg0806234971 G -> A LOC_Os08g10590-LOC_Os08g10600 intergenic_region ; MODIFIER silent_mutation Average:78.023; most accessible tissue: Zhenshan97 panicle, score: 95.493 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0806234971 G A -0.02 -0.03 -0.02 -0.02 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0806234971 2.57E-06 NA mr1115 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 1.71E-16 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 9.05E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 3.18E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 2.21E-06 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 2.06E-12 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 3.09E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 2.80E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 2.32E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 5.81E-11 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 8.92E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 2.43E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 1.61E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 9.36E-08 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 1.15E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 1.10E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 1.33E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 1.37E-06 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 7.92E-08 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 9.82E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 7.24E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 7.83E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 1.05E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 3.03E-11 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 9.96E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 2.45E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 3.83E-15 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806234971 NA 2.03E-08 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251