\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806189701:

Variant ID: vg0806189701 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 6189701
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTTAGACTCAACATTCATCTCCTTACACACGGCGAGAGAAAAACCAACGGTTCAAATAAAAGAGTACTTAGACTCCAAATTTCCAAACAACCCAAATTC[A/G]
ACTTGCTCAGAGCAAAAACAACAAGACAAAAACACGGGGAACGAAATAGATCAAAGCAATGCCTCAAGCTTCCAATCTTCTCCTTTGGTTCCAACCAAAC

Reverse complement sequence

GTTTGGTTGGAACCAAAGGAGAAGATTGGAAGCTTGAGGCATTGCTTTGATCTATTTCGTTCCCCGTGTTTTTGTCTTGTTGTTTTTGCTCTGAGCAAGT[T/C]
GAATTTGGGTTGTTTGGAAATTTGGAGTCTAAGTACTCTTTTATTTGAACCGTTGGTTTTTCTCTCGCCGTGTGTAAGGAGATGAATGTTGAGTCTAAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.40% 26.00% 0.15% 5.52% NA
All Indica  2759 92.30% 0.80% 0.11% 6.85% NA
All Japonica  1512 22.40% 77.30% 0.20% 0.07% NA
Aus  269 95.20% 0.00% 0.00% 4.83% NA
Indica I  595 98.30% 0.20% 0.00% 1.51% NA
Indica II  465 96.80% 2.40% 0.00% 0.86% NA
Indica III  913 87.80% 0.20% 0.11% 11.83% NA
Indica Intermediate  786 90.20% 0.90% 0.25% 8.65% NA
Temperate Japonica  767 34.60% 65.30% 0.13% 0.00% NA
Tropical Japonica  504 6.30% 93.30% 0.40% 0.00% NA
Japonica Intermediate  241 17.40% 82.20% 0.00% 0.41% NA
VI/Aromatic  96 39.60% 3.10% 1.04% 56.25% NA
Intermediate  90 57.80% 37.80% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0806189701 A -> G LOC_Os08g10540.1 downstream_gene_variant ; 64.0bp to feature; MODIFIER silent_mutation Average:28.941; most accessible tissue: Zhenshan97 young leaf, score: 54.618 N N N N
vg0806189701 A -> G LOC_Os08g10530-LOC_Os08g10540 intergenic_region ; MODIFIER silent_mutation Average:28.941; most accessible tissue: Zhenshan97 young leaf, score: 54.618 N N N N
vg0806189701 A -> DEL N N silent_mutation Average:28.941; most accessible tissue: Zhenshan97 young leaf, score: 54.618 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0806189701 8.39E-08 NA mr1002 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701 1.23E-06 7.05E-08 mr1002 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701 NA 2.80E-17 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701 NA 3.77E-06 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701 4.71E-06 3.49E-20 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701 9.03E-06 6.11E-10 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701 3.94E-06 3.94E-06 mr1525 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701 NA 1.30E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701 NA 1.32E-13 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701 NA 1.00E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701 NA 1.29E-15 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701 NA 5.26E-06 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701 NA 2.36E-19 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701 NA 1.97E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701 NA 1.20E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701 NA 3.77E-31 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701 NA 6.09E-07 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701 NA 1.51E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701 NA 1.36E-07 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701 NA 8.88E-19 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251