\
| Variant ID: vg0806189701 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 6189701 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCTTAGACTCAACATTCATCTCCTTACACACGGCGAGAGAAAAACCAACGGTTCAAATAAAAGAGTACTTAGACTCCAAATTTCCAAACAACCCAAATTC[A/G]
ACTTGCTCAGAGCAAAAACAACAAGACAAAAACACGGGGAACGAAATAGATCAAAGCAATGCCTCAAGCTTCCAATCTTCTCCTTTGGTTCCAACCAAAC
GTTTGGTTGGAACCAAAGGAGAAGATTGGAAGCTTGAGGCATTGCTTTGATCTATTTCGTTCCCCGTGTTTTTGTCTTGTTGTTTTTGCTCTGAGCAAGT[T/C]
GAATTTGGGTTGTTTGGAAATTTGGAGTCTAAGTACTCTTTTATTTGAACCGTTGGTTTTTCTCTCGCCGTGTGTAAGGAGATGAATGTTGAGTCTAAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.40% | 26.00% | 0.15% | 5.52% | NA |
| All Indica | 2759 | 92.30% | 0.80% | 0.11% | 6.85% | NA |
| All Japonica | 1512 | 22.40% | 77.30% | 0.20% | 0.07% | NA |
| Aus | 269 | 95.20% | 0.00% | 0.00% | 4.83% | NA |
| Indica I | 595 | 98.30% | 0.20% | 0.00% | 1.51% | NA |
| Indica II | 465 | 96.80% | 2.40% | 0.00% | 0.86% | NA |
| Indica III | 913 | 87.80% | 0.20% | 0.11% | 11.83% | NA |
| Indica Intermediate | 786 | 90.20% | 0.90% | 0.25% | 8.65% | NA |
| Temperate Japonica | 767 | 34.60% | 65.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 6.30% | 93.30% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 17.40% | 82.20% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 39.60% | 3.10% | 1.04% | 56.25% | NA |
| Intermediate | 90 | 57.80% | 37.80% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0806189701 | A -> G | LOC_Os08g10540.1 | downstream_gene_variant ; 64.0bp to feature; MODIFIER | silent_mutation | Average:28.941; most accessible tissue: Zhenshan97 young leaf, score: 54.618 | N | N | N | N |
| vg0806189701 | A -> G | LOC_Os08g10530-LOC_Os08g10540 | intergenic_region ; MODIFIER | silent_mutation | Average:28.941; most accessible tissue: Zhenshan97 young leaf, score: 54.618 | N | N | N | N |
| vg0806189701 | A -> DEL | N | N | silent_mutation | Average:28.941; most accessible tissue: Zhenshan97 young leaf, score: 54.618 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0806189701 | 8.39E-08 | NA | mr1002 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806189701 | 1.23E-06 | 7.05E-08 | mr1002 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806189701 | NA | 2.80E-17 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806189701 | NA | 3.77E-06 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806189701 | 4.71E-06 | 3.49E-20 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806189701 | 9.03E-06 | 6.11E-10 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806189701 | 3.94E-06 | 3.94E-06 | mr1525 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806189701 | NA | 1.30E-10 | mr1623 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806189701 | NA | 1.32E-13 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806189701 | NA | 1.00E-09 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806189701 | NA | 1.29E-15 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806189701 | NA | 5.26E-06 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806189701 | NA | 2.36E-19 | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806189701 | NA | 1.97E-06 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806189701 | NA | 1.20E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806189701 | NA | 3.77E-31 | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806189701 | NA | 6.09E-07 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806189701 | NA | 1.51E-10 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806189701 | NA | 1.36E-07 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806189701 | NA | 8.88E-19 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |