Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806189701:

Variant ID: vg0806189701 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 6189701
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTTAGACTCAACATTCATCTCCTTACACACGGCGAGAGAAAAACCAACGGTTCAAATAAAAGAGTACTTAGACTCCAAATTTCCAAACAACCCAAATTC[A/G]
ACTTGCTCAGAGCAAAAACAACAAGACAAAAACACGGGGAACGAAATAGATCAAAGCAATGCCTCAAGCTTCCAATCTTCTCCTTTGGTTCCAACCAAAC

Reverse complement sequence

GTTTGGTTGGAACCAAAGGAGAAGATTGGAAGCTTGAGGCATTGCTTTGATCTATTTCGTTCCCCGTGTTTTTGTCTTGTTGTTTTTGCTCTGAGCAAGT[T/C]
GAATTTGGGTTGTTTGGAAATTTGGAGTCTAAGTACTCTTTTATTTGAACCGTTGGTTTTTCTCTCGCCGTGTGTAAGGAGATGAATGTTGAGTCTAAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.40%	26.00%	0.15%	5.52%	NA
All Indica	2759	92.30%	0.80%	0.11%	6.85%	NA
All Japonica	1512	22.40%	77.30%	0.20%	0.07%	NA
Aus	269	95.20%	0.00%	0.00%	4.83%	NA
Indica I	595	98.30%	0.20%	0.00%	1.51%	NA
Indica II	465	96.80%	2.40%	0.00%	0.86%	NA
Indica III	913	87.80%	0.20%	0.11%	11.83%	NA
Indica Intermediate	786	90.20%	0.90%	0.25%	8.65%	NA
Temperate Japonica	767	34.60%	65.30%	0.13%	0.00%	NA
Tropical Japonica	504	6.30%	93.30%	0.40%	0.00%	NA
Japonica Intermediate	241	17.40%	82.20%	0.00%	0.41%	NA
VI/Aromatic	96	39.60%	3.10%	1.04%	56.25%	NA
Intermediate	90	57.80%	37.80%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0806189701	A -> G	LOC_Os08g10540.1	downstream_gene_variant ; 64.0bp to feature; MODIFIER	silent_mutation	Average:28.941; most accessible tissue: Zhenshan97 young leaf, score: 54.618	N	N	N	N
vg0806189701	A -> G	LOC_Os08g10530-LOC_Os08g10540	intergenic_region ; MODIFIER	silent_mutation	Average:28.941; most accessible tissue: Zhenshan97 young leaf, score: 54.618	N	N	N	N
vg0806189701	A -> DEL	N	N	silent_mutation	Average:28.941; most accessible tissue: Zhenshan97 young leaf, score: 54.618	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0806189701	8.39E-08	NA	mr1002	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701	1.23E-06	7.05E-08	mr1002	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701	NA	2.80E-17	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701	NA	3.77E-06	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701	4.71E-06	3.49E-20	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701	9.03E-06	6.11E-10	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701	3.94E-06	3.94E-06	mr1525	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701	NA	1.30E-10	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701	NA	1.32E-13	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701	NA	1.00E-09	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701	NA	1.29E-15	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701	NA	5.26E-06	mr1035_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701	NA	2.36E-19	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701	NA	1.97E-06	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701	NA	1.20E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701	NA	3.77E-31	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701	NA	6.09E-07	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701	NA	1.51E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701	NA	1.36E-07	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806189701	NA	8.88E-19	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251