\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806183176:

Variant ID: vg0806183176 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 6183176
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGAATAATCACAGTATCCGTCACATAAGGGGGTGTTTAGATCCAGGAATGTAAAGTTTTTGCGTGTAATATAATTATAGAATCCGTTAGTAAACCGCAA[A/G]
ACAAATTTATTAAGCCTAATTAATCCGTCATTAGCAAATCTTTGCTGTAGCACCACATTGTCAAATCATGGAGCAATTAGGCTTAAAATATTCGTCTCAC

Reverse complement sequence

GTGAGACGAATATTTTAAGCCTAATTGCTCCATGATTTGACAATGTGGTGCTACAGCAAAGATTTGCTAATGACGGATTAATTAGGCTTAATAAATTTGT[T/C]
TTGCGGTTTACTAACGGATTCTATAATTATATTACACGCAAAAACTTTACATTCCTGGATCTAAACACCCCCTTATGTGACGGATACTGTGATTATTCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.20% 33.90% 0.19% 4.70% NA
All Indica  2759 80.70% 13.00% 0.07% 6.23% NA
All Japonica  1512 21.20% 78.50% 0.26% 0.07% NA
Aus  269 78.10% 4.50% 0.00% 17.47% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 61.10% 10.80% 0.22% 27.96% NA
Indica III  913 77.40% 22.30% 0.00% 0.22% NA
Indica Intermediate  786 81.90% 12.80% 0.13% 5.09% NA
Temperate Japonica  767 32.70% 66.80% 0.52% 0.00% NA
Tropical Japonica  504 6.20% 93.80% 0.00% 0.00% NA
Japonica Intermediate  241 15.80% 83.80% 0.00% 0.41% NA
VI/Aromatic  96 92.70% 6.20% 0.00% 1.04% NA
Intermediate  90 51.10% 44.40% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0806183176 A -> G LOC_Os08g10530.1 upstream_gene_variant ; 1419.0bp to feature; MODIFIER silent_mutation Average:53.294; most accessible tissue: Callus, score: 80.221 N N N N
vg0806183176 A -> G LOC_Os08g10520.1 downstream_gene_variant ; 4159.0bp to feature; MODIFIER silent_mutation Average:53.294; most accessible tissue: Callus, score: 80.221 N N N N
vg0806183176 A -> G LOC_Os08g10530-LOC_Os08g10540 intergenic_region ; MODIFIER silent_mutation Average:53.294; most accessible tissue: Callus, score: 80.221 N N N N
vg0806183176 A -> DEL N N silent_mutation Average:53.294; most accessible tissue: Callus, score: 80.221 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0806183176 NA 2.96E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806183176 NA 1.49E-13 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806183176 NA 5.41E-06 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806183176 1.91E-07 2.69E-22 mr1062 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806183176 NA 1.53E-08 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806183176 NA 1.15E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806183176 NA 1.94E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806183176 NA 1.09E-14 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806183176 NA 8.47E-06 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806183176 NA 2.22E-06 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251