\
| Variant ID: vg0806183176 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 6183176 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAGAATAATCACAGTATCCGTCACATAAGGGGGTGTTTAGATCCAGGAATGTAAAGTTTTTGCGTGTAATATAATTATAGAATCCGTTAGTAAACCGCAA[A/G]
ACAAATTTATTAAGCCTAATTAATCCGTCATTAGCAAATCTTTGCTGTAGCACCACATTGTCAAATCATGGAGCAATTAGGCTTAAAATATTCGTCTCAC
GTGAGACGAATATTTTAAGCCTAATTGCTCCATGATTTGACAATGTGGTGCTACAGCAAAGATTTGCTAATGACGGATTAATTAGGCTTAATAAATTTGT[T/C]
TTGCGGTTTACTAACGGATTCTATAATTATATTACACGCAAAAACTTTACATTCCTGGATCTAAACACCCCCTTATGTGACGGATACTGTGATTATTCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.20% | 33.90% | 0.19% | 4.70% | NA |
| All Indica | 2759 | 80.70% | 13.00% | 0.07% | 6.23% | NA |
| All Japonica | 1512 | 21.20% | 78.50% | 0.26% | 0.07% | NA |
| Aus | 269 | 78.10% | 4.50% | 0.00% | 17.47% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 61.10% | 10.80% | 0.22% | 27.96% | NA |
| Indica III | 913 | 77.40% | 22.30% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 81.90% | 12.80% | 0.13% | 5.09% | NA |
| Temperate Japonica | 767 | 32.70% | 66.80% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 15.80% | 83.80% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 92.70% | 6.20% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 51.10% | 44.40% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0806183176 | A -> G | LOC_Os08g10530.1 | upstream_gene_variant ; 1419.0bp to feature; MODIFIER | silent_mutation | Average:53.294; most accessible tissue: Callus, score: 80.221 | N | N | N | N |
| vg0806183176 | A -> G | LOC_Os08g10520.1 | downstream_gene_variant ; 4159.0bp to feature; MODIFIER | silent_mutation | Average:53.294; most accessible tissue: Callus, score: 80.221 | N | N | N | N |
| vg0806183176 | A -> G | LOC_Os08g10530-LOC_Os08g10540 | intergenic_region ; MODIFIER | silent_mutation | Average:53.294; most accessible tissue: Callus, score: 80.221 | N | N | N | N |
| vg0806183176 | A -> DEL | N | N | silent_mutation | Average:53.294; most accessible tissue: Callus, score: 80.221 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0806183176 | NA | 2.96E-07 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806183176 | NA | 1.49E-13 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806183176 | NA | 5.41E-06 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806183176 | 1.91E-07 | 2.69E-22 | mr1062 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806183176 | NA | 1.53E-08 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806183176 | NA | 1.15E-06 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806183176 | NA | 1.94E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806183176 | NA | 1.09E-14 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806183176 | NA | 8.47E-06 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806183176 | NA | 2.22E-06 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |