\
| Variant ID: vg0806118132 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 6118132 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCGCGCCCACGCCTCCGCCTCCTCCGGGCCACGTGACCACCGCGTGTGTTCCGCGTGTGTGCCACGTCGGCGCCATGTGGTGCGCCCCTTCTCCCCAGTC[C/T]
GTGAACCCGATCCACCATGGACTCGCGCCCGCAGCCGCTGACATGTGGGGCCCGCATGTCGGCGCCGCCCTCTCTCTCGTCGGGATTTAATTATTGCGCA
TGCGCAATAATTAAATCCCGACGAGAGAGAGGGCGGCGCCGACATGCGGGCCCCACATGTCAGCGGCTGCGGGCGCGAGTCCATGGTGGATCGGGTTCAC[G/A]
GACTGGGGAGAAGGGGCGCACCACATGGCGCCGACGTGGCACACACGCGGAACACACGCGGTGGTCACGTGGCCCGGAGGAGGCGGAGGCGTGGGCGCGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.40% | 9.40% | 0.23% | 7.93% | NA |
| All Indica | 2759 | 88.10% | 0.40% | 0.07% | 11.45% | NA |
| All Japonica | 1512 | 71.10% | 27.90% | 0.40% | 0.60% | NA |
| Aus | 269 | 85.50% | 0.00% | 0.74% | 13.75% | NA |
| Indica I | 595 | 97.50% | 0.00% | 0.00% | 2.52% | NA |
| Indica II | 465 | 96.30% | 1.70% | 0.00% | 1.94% | NA |
| Indica III | 913 | 78.20% | 0.10% | 0.22% | 21.47% | NA |
| Indica Intermediate | 786 | 87.50% | 0.30% | 0.00% | 12.21% | NA |
| Temperate Japonica | 767 | 78.00% | 21.60% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 56.90% | 41.30% | 0.00% | 1.79% | NA |
| Japonica Intermediate | 241 | 78.80% | 19.90% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 0.00% | 0.00% | 9.38% | NA |
| Intermediate | 90 | 80.00% | 14.40% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0806118132 | C -> T | LOC_Os08g10410.1 | upstream_gene_variant ; 2468.0bp to feature; MODIFIER | silent_mutation | Average:70.965; most accessible tissue: Minghui63 panicle, score: 89.949 | N | N | N | N |
| vg0806118132 | C -> T | LOC_Os08g10420.1 | downstream_gene_variant ; 3686.0bp to feature; MODIFIER | silent_mutation | Average:70.965; most accessible tissue: Minghui63 panicle, score: 89.949 | N | N | N | N |
| vg0806118132 | C -> T | LOC_Os08g10410-LOC_Os08g10420 | intergenic_region ; MODIFIER | silent_mutation | Average:70.965; most accessible tissue: Minghui63 panicle, score: 89.949 | N | N | N | N |
| vg0806118132 | C -> DEL | N | N | silent_mutation | Average:70.965; most accessible tissue: Minghui63 panicle, score: 89.949 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0806118132 | 3.02E-06 | NA | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806118132 | NA | 5.50E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806118132 | NA | 8.49E-06 | mr1355_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806118132 | 4.46E-07 | NA | mr1588_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |