\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806098917:

Variant ID: vg0806098917 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 6098917
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCGAGAACAATTGAGCACTCGAGTAGGTTGTGGTCAAACACTCACATTATCGAGAACGTTCTCGACAAATGCAGAGTTGTCGCACCCAACTTACCAAT[G/A]
AAGACCGACGACCTATCTCATAGCACCGGCCATAGCTGAGCTATTCGAGAAAAGGTTGTTAACGGATAATTCCTCGTAAACATTGTTGGCTTGATCACCC

Reverse complement sequence

GGGTGATCAAGCCAACAATGTTTACGAGGAATTATCCGTTAACAACCTTTTCTCGAATAGCTCAGCTATGGCCGGTGCTATGAGATAGGTCGTCGGTCTT[C/T]
ATTGGTAAGTTGGGTGCGACAACTCTGCATTTGTCGAGAACGTTCTCGATAATGTGAGTGTTTGACCACAACCTACTCGAGTGCTCAATTGTTCTCGAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.30% 6.60% 2.84% 0.32% NA
All Indica  2759 84.00% 11.20% 4.78% 0.04% NA
All Japonica  1512 99.10% 0.00% 0.07% 0.79% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 53.60% 30.60% 15.80% 0.00% NA
Indica II  465 90.50% 6.50% 3.01% 0.00% NA
Indica III  913 99.70% 0.20% 0.00% 0.11% NA
Indica Intermediate  786 85.00% 12.00% 3.05% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 97.80% 0.00% 0.00% 2.18% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 94.40% 3.30% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0806098917 G -> A LOC_Os08g10400.1 downstream_gene_variant ; 4056.0bp to feature; MODIFIER silent_mutation Average:39.201; most accessible tissue: Minghui63 flag leaf, score: 49.864 N N N N
vg0806098917 G -> A LOC_Os08g10390.1 intron_variant ; MODIFIER silent_mutation Average:39.201; most accessible tissue: Minghui63 flag leaf, score: 49.864 N N N N
vg0806098917 G -> DEL N N silent_mutation Average:39.201; most accessible tissue: Minghui63 flag leaf, score: 49.864 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0806098917 NA 3.65E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806098917 NA 6.01E-06 mr1045_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806098917 NA 5.98E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806098917 NA 1.94E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806098917 4.73E-07 4.73E-07 mr1615_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806098917 NA 5.83E-06 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806098917 NA 9.18E-06 mr1729_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251