\
| Variant ID: vg0806098917 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 6098917 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 300. )
TTTCGAGAACAATTGAGCACTCGAGTAGGTTGTGGTCAAACACTCACATTATCGAGAACGTTCTCGACAAATGCAGAGTTGTCGCACCCAACTTACCAAT[G/A]
AAGACCGACGACCTATCTCATAGCACCGGCCATAGCTGAGCTATTCGAGAAAAGGTTGTTAACGGATAATTCCTCGTAAACATTGTTGGCTTGATCACCC
GGGTGATCAAGCCAACAATGTTTACGAGGAATTATCCGTTAACAACCTTTTCTCGAATAGCTCAGCTATGGCCGGTGCTATGAGATAGGTCGTCGGTCTT[C/T]
ATTGGTAAGTTGGGTGCGACAACTCTGCATTTGTCGAGAACGTTCTCGATAATGTGAGTGTTTGACCACAACCTACTCGAGTGCTCAATTGTTCTCGAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.30% | 6.60% | 2.84% | 0.32% | NA |
| All Indica | 2759 | 84.00% | 11.20% | 4.78% | 0.04% | NA |
| All Japonica | 1512 | 99.10% | 0.00% | 0.07% | 0.79% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 53.60% | 30.60% | 15.80% | 0.00% | NA |
| Indica II | 465 | 90.50% | 6.50% | 3.01% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.20% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 85.00% | 12.00% | 3.05% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 97.80% | 0.00% | 0.00% | 2.18% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 94.40% | 3.30% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0806098917 | G -> A | LOC_Os08g10400.1 | downstream_gene_variant ; 4056.0bp to feature; MODIFIER | silent_mutation | Average:39.201; most accessible tissue: Minghui63 flag leaf, score: 49.864 | N | N | N | N |
| vg0806098917 | G -> A | LOC_Os08g10390.1 | intron_variant ; MODIFIER | silent_mutation | Average:39.201; most accessible tissue: Minghui63 flag leaf, score: 49.864 | N | N | N | N |
| vg0806098917 | G -> DEL | N | N | silent_mutation | Average:39.201; most accessible tissue: Minghui63 flag leaf, score: 49.864 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0806098917 | NA | 3.65E-06 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806098917 | NA | 6.01E-06 | mr1045_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806098917 | NA | 5.98E-09 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806098917 | NA | 1.94E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806098917 | 4.73E-07 | 4.73E-07 | mr1615_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806098917 | NA | 5.83E-06 | mr1629_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806098917 | NA | 9.18E-06 | mr1729_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |