\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806074323:

Variant ID: vg0806074323 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 6074323
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGCCATCAGGCCGGTCTGACCGCCGACCTGACGACAGTCTGACCGACGCCTCAGGCCGGTCTAACCGTGTGCCACACGTCGGTCTGACCGACGCGTCTG[G/A]
CCGGTCTGACCGGTGGTCTACAGCCGGTCTGACCGAGCTCCAGCGCCGGTTTGATGAGAGGGCTGCAAAGGGCGATGTGAGGGCTTCATCGTCTCCAAGC

Reverse complement sequence

GCTTGGAGACGATGAAGCCCTCACATCGCCCTTTGCAGCCCTCTCATCAAACCGGCGCTGGAGCTCGGTCAGACCGGCTGTAGACCACCGGTCAGACCGG[C/T]
CAGACGCGTCGGTCAGACCGACGTGTGGCACACGGTTAGACCGGCCTGAGGCGTCGGTCAGACTGTCGTCAGGTCGGCGGTCAGACCGGCCTGATGGCCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.30% 10.30% 0.17% 1.14% NA
All Indica  2759 97.60% 0.40% 0.11% 1.96% NA
All Japonica  1512 68.70% 31.00% 0.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.60% 0.00% 0.50% 2.86% NA
Indica II  465 97.00% 1.50% 0.00% 1.51% NA
Indica III  913 98.00% 0.10% 0.00% 1.86% NA
Indica Intermediate  786 98.10% 0.30% 0.00% 1.65% NA
Temperate Japonica  767 64.80% 34.80% 0.39% 0.00% NA
Tropical Japonica  504 66.70% 33.10% 0.20% 0.00% NA
Japonica Intermediate  241 85.50% 14.50% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 11.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0806074323 G -> A LOC_Os08g10360.1 missense_variant ; p.Gly668Asp; MODERATE nonsynonymous_codon ; G668D Average:76.392; most accessible tissue: Minghui63 flag leaf, score: 95.901 probably damaging 2.049 TOLERATED 0.30
vg0806074323 G -> DEL LOC_Os08g10360.1 N frameshift_variant Average:76.392; most accessible tissue: Minghui63 flag leaf, score: 95.901 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0806074323 G A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0806074323 3.11E-06 NA mr1986 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806074323 9.66E-06 9.66E-06 mr1986 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806074323 3.17E-06 NA mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251