| Variant ID: vg0806066076 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 6066076 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CCTAAATGACACACTATGACAAGTTCTGGGACTTGGATATACATTTTAAGAGTTTAGGGACCTAGATGACACACCCCTACAAGTTTAAGGACCGCCCGTA[T/C]
ACTTTACTCCTAATTTTTATATGGGGCAATTGCGTTTTTATCTTTTTTTTAAGACTAACTACTAATTTGGCCATACTTTTTCGAGTTTTCTCATTTGACC
GGTCAAATGAGAAAACTCGAAAAAGTATGGCCAAATTAGTAGTTAGTCTTAAAAAAAAGATAAAAACGCAATTGCCCCATATAAAAATTAGGAGTAAAGT[A/G]
TACGGGCGGTCCTTAAACTTGTAGGGGTGTGTCATCTAGGTCCCTAAACTCTTAAAATGTATATCCAAGTCCCAGAACTTGTCATAGTGTGTCATTTAGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 10.10% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 87.00% | 12.90% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 79.90% | 19.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 76.20% | 23.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 44.80% | 55.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0806066076 | T -> C | LOC_Os08g10350.1 | upstream_gene_variant ; 683.0bp to feature; MODIFIER | silent_mutation | Average:54.406; most accessible tissue: Minghui63 root, score: 70.803 | N | N | N | N |
| vg0806066076 | T -> C | LOC_Os08g10350-LOC_Os08g10360 | intergenic_region ; MODIFIER | silent_mutation | Average:54.406; most accessible tissue: Minghui63 root, score: 70.803 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0806066076 | NA | 5.95E-06 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806066076 | NA | 5.34E-07 | mr1195 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806066076 | 2.22E-06 | NA | mr1721 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806066076 | 5.73E-06 | 7.26E-06 | mr1721 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |