Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806058149:

Variant ID: vg0806058149 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 6058149
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATTTGTTAACAGTTTTATACCTATTATAATAGAAAATAAGAGTCAAAGTTGTTTTTTGGAGACCGTGCCCTTGTCCAAAACGACAAGTATTATCAGCCC[G/A]
GAGGGAGTATCATTTAGTGATATTAGTACACACCAATACATCACTCACTAGTACTAAAACAGATGCTAATACTTCCTATTATATTGAACTTTCAATGATG

Reverse complement sequence

CATCATTGAAAGTTCAATATAATAGGAAGTATTAGCATCTGTTTTAGTACTAGTGAGTGATGTATTGGTGTGTACTAATATCACTAAATGATACTCCCTC[C/T]
GGGCTGATAATACTTGTCGTTTTGGACAAGGGCACGGTCTCCAAAAAACAACTTTGACTCTTATTTTCTATTATAATAGGTATAAAACTGTTAACAAATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.80%	18.40%	0.57%	24.25%	NA
All Indica	2759	60.90%	0.30%	0.72%	38.09%	NA
All Japonica	1512	42.90%	55.80%	0.13%	1.19%	NA
Aus	269	95.20%	0.00%	0.74%	4.09%	NA
Indica I	595	23.00%	0.30%	0.50%	76.13%	NA
Indica II	465	65.60%	0.40%	0.00%	33.98%	NA
Indica III	913	81.10%	0.00%	1.42%	17.52%	NA
Indica Intermediate	786	63.50%	0.40%	0.51%	35.62%	NA
Temperate Japonica	767	58.00%	40.00%	0.00%	1.96%	NA
Tropical Japonica	504	24.00%	75.60%	0.40%	0.00%	NA
Japonica Intermediate	241	34.00%	64.70%	0.00%	1.24%	NA
VI/Aromatic	96	47.90%	3.10%	2.08%	46.88%	NA
Intermediate	90	57.80%	17.80%	1.11%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0806058149	G -> A	LOC_Os08g10350.1	downstream_gene_variant ; 4623.0bp to feature; MODIFIER	silent_mutation	Average:44.063; most accessible tissue: Minghui63 flag leaf, score: 62.47	N	N	N	N
vg0806058149	G -> A	LOC_Os08g10340.1	intron_variant ; MODIFIER	silent_mutation	Average:44.063; most accessible tissue: Minghui63 flag leaf, score: 62.47	N	N	N	N
vg0806058149	G -> DEL	N	N	silent_mutation	Average:44.063; most accessible tissue: Minghui63 flag leaf, score: 62.47	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0806058149	NA	1.13E-08	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	3.32E-19	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	3.49E-18	mr1715	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	1.26E-13	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	8.51E-21	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	3.70E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	2.74E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	1.96E-10	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	1.97E-11	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	3.36E-07	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	2.53E-06	mr1397_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	4.27E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	8.21E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	1.32E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	2.81E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	2.46E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	9.89E-06	mr1556_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	5.68E-16	mr1578_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	9.92E-12	mr1641_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	1.37E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	2.20E-09	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	1.02E-17	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	7.10E-06	7.08E-06	mr1760_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	7.55E-06	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	9.62E-06	mr1812_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	1.47E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	3.30E-10	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806058149	NA	1.40E-13	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251