\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805967435:

Variant ID: vg0805967435 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5967435
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


GCCTTCAATACCCACAAGATTAGCGGCTTCACTGTACAGTGCTGGCAACCGAGGATCAATGGCCACAAAGCTAGAACTAGGAGTGTCATCTAGATCAAAT[T/C]
TGTACCTCTTGTGCCGTTCATTTATCTCTATTAGCTGAATCTTGAGATCCTTGATATGCTCGGCAGTCTCAAGACGGGCCCTCAAAGTTCTGAGAAAGTG

Reverse complement sequence

CACTTTCTCAGAACTTTGAGGGCCCGTCTTGAGACTGCCGAGCATATCAAGGATCTCAAGATTCAGCTAATAGAGATAAATGAACGGCACAAGAGGTACA[A/G]
ATTTGATCTAGATGACACTCCTAGTTCTAGCTTTGTGGCCATTGATCCTCGGTTGCCAGCACTGTACAGTGAAGCCGCTAATCTTGTGGGTATTGAAGGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.40% 32.90% 0.76% 0.00% NA
All Indica  2759 49.20% 49.70% 1.05% 0.00% NA
All Japonica  1512 98.00% 1.90% 0.13% 0.00% NA
Aus  269 54.60% 44.60% 0.74% 0.00% NA
Indica I  595 46.10% 51.80% 2.18% 0.00% NA
Indica II  465 52.90% 46.70% 0.43% 0.00% NA
Indica III  913 53.10% 46.50% 0.33% 0.00% NA
Indica Intermediate  786 44.90% 53.70% 1.40% 0.00% NA
Temperate Japonica  767 98.20% 1.80% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 1.80% 0.20% 0.00% NA
Japonica Intermediate  241 97.50% 2.10% 0.41% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 67.80% 28.90% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805967435 T -> C LOC_Os08g10260.1 missense_variant ; p.Lys138Arg; MODERATE nonsynonymous_codon ; K138R Average:82.862; most accessible tissue: Callus, score: 89.28 unknown unknown TOLERATED 0.08

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0805967435 T C 0.05 0.04 0.04 0.05 0.07 0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805967435 NA 4.18E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805967435 NA 2.56E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805967435 9.93E-07 9.91E-07 mr1615_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805967435 1.81E-06 1.81E-06 mr1615_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251